Take the 2-minute tour ×
Biology Stack Exchange is a question and answer site for biology researchers, academics, and students. It's 100% free, no registration required.

I tried to clone a 5 kb gene with few success. The primers used are this

OLIGO start len tm gc% any 3' seq LEFT PRIMER 1 22 62.53 50.00 4.00 2.00 ATGCCGCGTAAACCTAGACATC RIGHT PRIMER 5119 23 59.68 39.13 4.00 3.00 ATAATTCAACTTCCACAGCGAAG SEQUENCE SIZE: 5119 INCLUDED REGION SIZE: 5119

PRODUCT SIZE: 5119, PAIR ANY COMPL: 3.00, PAIR 3' COMPL: 2.00

In order to perform subsequent ligation in plasmid recombination sequences were added to the primers (gateway)

5´ GGGG ACA AGT TTG TAC AAA AAA GCA GGC TCT ATGCCGCGTAAACCTAGACATC 5´ GAAGCGACACCTTCAACTTAAT ACT GGG TCG AAA GAA CAT GTT TCA CCA GGGG

(and the analysis of those two in idtdna oligo analyzer)

RESULTS Dilution

Resuspension SEQUENCE: 5'- GGG GAC AAG TTT GTA CAA AAA AGC AGG CTC TAT GCC GCG TAA ACC TAG ACA TC -3' COMPLEMENT: 5'- GAT GTC TAG GTT TAC GCG GCA TAG AGC CTG CTT TTT TGT ACA AAC TTG TCC CC -3' LENGTH: 53 GC CONTENT: 47.2 % MELT TEMP: 68.4 ºC MOLECULAR WEIGHT: 16367.7 g/mole EXTINCTION COEFFICIENT: 526400 L/(mole·cm) nmole/OD260: 1.90 µg/OD260: 31.09

MELTING TEMPERATURE SETTINGS TARGET TYPE: DNA OLIGO CONC 0.25 µM Na+ CONC 50 mM monovalent salt Mg++ CONC 0 mM divalent salt dNTPs CONC 0 mM nucleotide triphosphate

AND

RESULTS Dilution

Resuspension SEQUENCE: 5'- GAA GCG ACA CCT TCA ACT TAA TAC TGG GTC GAA AGA ACA TGT TTC ACC AGG GG -3' COMPLEMENT: 5'- CCC CTG GTG AAA CAT GTT CTT TCG ACC CAG TAT TAA GTT GAA GGT GTC GCT TC -3' LENGTH: 53 GC CONTENT: 47.2 % MELT TEMP: 68.2 ºC MOLECULAR WEIGHT: 16358.7 g/mole EXTINCTION COEFFICIENT: 523200 L/(mole·cm) nmole/OD260: 1.91 µg/OD260: 31.27

MELTING TEMPERATURE SETTINGS TARGET TYPE: DNA OLIGO CONC 0.25 µM Na+ CONC 50 mM monovalent salt Mg++ CONC 0 mM divalent salt dNTPs CONC 0 mM nucleotide triphosphate

THE PCR SCHEDULE FOLLOWED WAS: Start 94ºC 3´

Denaturation 94ºC 30´´ Primer hibrydization 53ºC 45´´ Polimerization 68ºC 5´

ten cycles in order that only the site of the primers complementari to the gene is hibridizated, so that we amplificate strands with the ligation fragments. Then..

Denaturation 94ºC 30´´ primer hibrydization 64ºC 45´´ Polimerization 68ºC 5´

25 cycles, so that the whole sequence of the primers (including to ligation part) is in optimized temperature to hydridize the recently "whole sequence" including fragments

Elongation 68ºC 5´ Final hold 4ºC 10´

Does anyone see any mistake? because we didnt get any 5 kb amplicon

share|improve this question
    
Please edit your question and use either comment or code blocks to fix the format. It is impossible to read at the moment. –  terdon Nov 14 '13 at 12:06

Your Answer

 
discard

By posting your answer, you agree to the privacy policy and terms of service.

Browse other questions tagged or ask your own question.