Take the 2-minute tour ×
Biology Stack Exchange is a question and answer site for biology researchers, academics, and students. It's 100% free, no registration required.

I tried to clone a 5 kb gene with few success. The primers used are this

OLIGO start len tm gc% any 3' seq LEFT PRIMER 1 22 62.53 50.00 4.00 2.00 ATGCCGCGTAAACCTAGACATC RIGHT PRIMER 5119 23 59.68 39.13 4.00 3.00 ATAATTCAACTTCCACAGCGAAG SEQUENCE SIZE: 5119 INCLUDED REGION SIZE: 5119

PRODUCT SIZE: 5119, PAIR ANY COMPL: 3.00, PAIR 3' COMPL: 2.00

In order to perform subsequent ligation in plasmid recombination sequences were added to the primers (gateway)

5´ GGGG ACA AGT TTG TAC AAA AAA GCA GGC TCT ATGCCGCGTAAACCTAGACATC 5´ GAAGCGACACCTTCAACTTAAT ACT GGG TCG AAA GAA CAT GTT TCA CCA GGGG

(and the analysis of those two in idtdna oligo analyzer)

RESULTS Dilution

Resuspension SEQUENCE: 5'- GGG GAC AAG TTT GTA CAA AAA AGC AGG CTC TAT GCC GCG TAA ACC TAG ACA TC -3' COMPLEMENT: 5'- GAT GTC TAG GTT TAC GCG GCA TAG AGC CTG CTT TTT TGT ACA AAC TTG TCC CC -3' LENGTH: 53 GC CONTENT: 47.2 % MELT TEMP: 68.4 ºC MOLECULAR WEIGHT: 16367.7 g/mole EXTINCTION COEFFICIENT: 526400 L/(mole·cm) nmole/OD260: 1.90 µg/OD260: 31.09

MELTING TEMPERATURE SETTINGS TARGET TYPE: DNA OLIGO CONC 0.25 µM Na+ CONC 50 mM monovalent salt Mg++ CONC 0 mM divalent salt dNTPs CONC 0 mM nucleotide triphosphate

AND

RESULTS Dilution

Resuspension SEQUENCE: 5'- GAA GCG ACA CCT TCA ACT TAA TAC TGG GTC GAA AGA ACA TGT TTC ACC AGG GG -3' COMPLEMENT: 5'- CCC CTG GTG AAA CAT GTT CTT TCG ACC CAG TAT TAA GTT GAA GGT GTC GCT TC -3' LENGTH: 53 GC CONTENT: 47.2 % MELT TEMP: 68.2 ºC MOLECULAR WEIGHT: 16358.7 g/mole EXTINCTION COEFFICIENT: 523200 L/(mole·cm) nmole/OD260: 1.91 µg/OD260: 31.27

MELTING TEMPERATURE SETTINGS TARGET TYPE: DNA OLIGO CONC 0.25 µM Na+ CONC 50 mM monovalent salt Mg++ CONC 0 mM divalent salt dNTPs CONC 0 mM nucleotide triphosphate

THE PCR SCHEDULE FOLLOWED WAS: Start 94ºC 3´

Denaturation 94ºC 30´´ Primer hibrydization 53ºC 45´´ Polimerization 68ºC 5´

ten cycles in order that only the site of the primers complementari to the gene is hibridizated, so that we amplificate strands with the ligation fragments. Then..

Denaturation 94ºC 30´´ primer hibrydization 64ºC 45´´ Polimerization 68ºC 5´

25 cycles, so that the whole sequence of the primers (including to ligation part) is in optimized temperature to hydridize the recently "whole sequence" including fragments

Elongation 68ºC 5´ Final hold 4ºC 10´

Does anyone see any mistake? because we didnt get any 5 kb amplicon

share|improve this question

closed as unclear what you're asking by Chris, Bez, GriffinEvo, Chris Stronks, user137 Dec 8 at 23:49

Please clarify your specific problem or add additional details to highlight exactly what you need. As it's currently written, it’s hard to tell exactly what you're asking. See the How to Ask page for help clarifying this question.If this question can be reworded to fit the rules in the help center, please edit the question.

    
Please edit your question and use either comment or code blocks to fix the format. It is impossible to read at the moment. –  terdon Nov 14 '13 at 12:06

Browse other questions tagged or ask your own question.