Take the 2-minute tour ×
Biology Stack Exchange is a question and answer site for biology researchers, academics, and students. It's 100% free, no registration required.

I understand that someones genetic makeup at an allele is usually denoted as (AA,Aa,aa).

That means that instead of an A-T pair you get a C-G pair on none, 1 or 2 copies.

Now, what exactly happens when you have a tri-allele (as in blood type). Are they looking at two base positions? Or is it instead of an A -> C mutation, you get something weirder like an A->G mutation (and thus you need to account for directionality) etc?

Thanks!

share|improve this question

3 Answers 3

up vote 1 down vote accepted

All of these things happen, but triallelic SNPs (single nucleotide polymorphisms) refer to the case where a single specific base in the genome may have one of three bases. e.g.: A/G/C

Cases where more than one base in a sequence that changes. This doesn't really have a name though: (e.g. AA -> GC ).

These can be called a/b/c alleles I guess.

The reason for this not having a name is probably because two bases don't really change at the same time as a common event. If two SNPs are next to each other they probably changed at different times, which means that if you look around enough you will find AA, GC, and GA because the A->G happened first and then a few dozen generations the second A->C mutation happened.

share|improve this answer
1  
Ah, I see, so if the sequence is TCGAT and that the 3 position by default is a G, but can be an A or T that would be tri-allelic. if it can be A,C,G or T, then it's quad-allelic? Can you go higher than a 4 way somehow? –  user1357015 May 2 at 22:07
1  
@user1357015 not at a single point, because there are only 4 bases in DNA. However, any one gene may have from a few to hundreds of SNPs, each one creating a separate "allele." –  MattDMo May 2 at 22:33
    
@MattDMo ah, I see. So a single point can be at most tri-allelic but a gene can be multi-allelic. In fact, if a gene is N bases long, it can then be 3N-allelic? Is that correct? –  user1357015 May 3 at 1:31
    
yup - you got it. additional point is that each new addition to the allele is a separate mutation - it just happened in the same place –  shigeta May 3 at 13:52
1  
There are only 4 bases of DNA, but you can have insertions and deletions as well. You can also have alleles that differ at multiple points, so no, there are a lot more than 3 x the length of the gene possible alleles. Of course, you will only see so many possibilities in a real population. –  swbarnes2 May 3 at 18:18

I understand that someones genetic makeup at an allele is usually denoted as (AA,Aa,aa).

No. That's what you learn in high school, because it's easy, and because it's what Mendel worked out for the 7 traits he studied in pea plants. Real life is a lot more complex. Most phenotypic differences cannot be explained in terms of exactly two alleles, one of which is classically dominant to the other.

That means that instead of an A-T pair you get a C-G pair on none, 1 or 2 copies.

Not necessarily. Two alleles might differ at many many points in their sequence.

And you seem to be a bit confused about how people write out DNA sequence. Even though DNA is a double helix, when we talk about what the sequence is, we refer only to one strand, like this

GAGCCATGGGGCGCCATGTTGCCACCAGCTGCCACGTGGCCTGGCTTTTGGTGCTGATCT

A mutation might turn that last T into an A, but we don't say "oh, nothing happened, it's still an A-T pair" because it matters which strand has which letter.

Now, what exactly happens when you have a tri-allele (as in blood type).

Well, blood type is more complicated that just ABO...but here's a pretty old paper with some helpful details

http://www.ncbi.nlm.nih.gov/pubmed/2333095

"Here we present a molecular basis for the ABO genotypes. The A and B genes differ in a few single-base substitutions, changing four amino-acid residues that may cause differences in A and B transferase specificity. A critical single-base deletion was found in the O gene, which results in an entirely different, inactive protein incapable of modifying the H antigen."

share|improve this answer

I'm not sure you've got a really solid understanding of what an allele is, so let me blather a bit and see if it helps.

The gene that codes for the enzyme that puts the "A" type of carbohydrate on a red blood cell is called the "IA" allele of the gene. This gene is about 1065 base pairs long. If you were to spell it out, it would look like:

CAATGGCCGGGTAATTAAAATTGACGAC...

GTTACCGGCCCATTAATTTTAACTGCTG... (keep going to 1065 letters)

The most common O allele has the same series of base pairs, except one base pair (G_C) is lost at the 261 position. This is a deletion mutation.

The most common B allele is the same gene sequence, except there are seven single base substitutions within the coding sequence at base pairs 297, 526, 657, 703, 796, 803 and 930. These are substitution mutations.

Does that make sense? The basic ABO blood-type gene is almost the same in each allele, but has slight changes that result in different phenotypes. And this is the simple version. Now that we can easily sequence genes, we can look in lots of people, and see that there are at least TWENTY different gene sequences with small changes in base pairs that still result in type "A" blood. You can see a figure with examples in this paper: http://www.ncbi.nlm.nih.gov/pubmed/12014997 (open-source)

So, since one gene has hundreds of base pairs, there are often many more than two, three or four alleles for that gene. You can add base pairs, delete them, change them, switch them in chunks from other chromosomes -- all kinds of stuff happens.

share|improve this answer

Your Answer

 
discard

By posting your answer, you agree to the privacy policy and terms of service.

Not the answer you're looking for? Browse other questions tagged or ask your own question.