Take the 2-minute tour ×
Biology Stack Exchange is a question and answer site for biology researchers, academics, and students. It's 100% free, no registration required.

I'm trying to design a primer for Gibson assembly. My gene of interest is on a plasmid, and I want to copy that gene, and put it into a different plasmid.

I am unsure how to design my primers for PCR. I know that I need 2 sets of primers (4 total).

  1. Backward and forward primer to copy my gene out of the plasmid that holds it.
  2. Backward and forward primer to copy the plasmid.

I also know that I need to create complementary regions of overlap between my gene and the plasmid I want to put it in. How do I do this?

Here is the plasmid and the gene. I want to place the gene in between the biobrick prefix and suffix.

Here is what primers I think I need:

For the plasmid I want to put the gene in, my primers should be

  • Forward: ATTCGCGGCCGCTTCTAGAG
  • Reverse: CTGACGCGGCCGCTACTAGTA

Primers to copy gene and add overlap

  • Reverse: ATCATTTCAAATTCGTCCATCTCTAGAAGCGGCCGCGAAT
  • Forward: AATTAGAAAGAGATTATAATACTAGTAGCGGCCGCTGCA

Here is the gene

Here is the plasmid I want to put it in. I am using geneious, but I think for this purpose, word works just fine.

share|improve this question
    
your gene is 5kb long.. you cant assemble it with 4 primers.. BTW.. why do you need to assemble it ? you can do a normal PCR.. easier –  WYSIWYG May 17 '13 at 9:33
    
@WYSIWYG the TyrRs gene is just 1920 bp of the plasmid in the linked file. –  Alan Boyd May 17 '13 at 10:50
    
@AlanBoyd.. that would still require more than 4 primers to assemble it.. To assemble a ~320bp fragment I used four 90mers.. –  WYSIWYG May 18 '13 at 7:54
    
Marco... I think what you want to do is a nested PCR.. in gibson assembly you assemble the entire DNA fragment using several small oligos.. –  WYSIWYG May 18 '13 at 7:57

3 Answers 3

Disclaimer: I haven't ever done a Gibson assembly, but here is my theoretical understanding of how to design your primers. You need four 40mers each consisting of 20 bp segments derived from the vector and the insert and corresponding to the junctions that you are trying to create. In the diagram below the dotted lines represent the junctions between the two 20 bp segments of each 40mer.

enter image description here

share|improve this answer

Here is a good overview of primer design considerations when using Gibson assembly. http://j5.jbei.org/j5manual/pages/22.html

share|improve this answer
    
it says can linearize the plasmid by cutting it and so you'd only need 2 primers to clone the insert. what advantage is there clone the vector as well? I guess it saves a miniprep, but 2 oligos cost more than a miniprep does.. –  shigeta May 21 '13 at 12:58
1  
Well the downside to cutting the vector is that a restriction site must already exist at the junction. This is a major limitation that Gibson overcomes. The potential downsides of using PCR to amplify the backbone: you might have problems getting PCR to work (always a potential problem), and there is a minimal risk of introducing mutations during PCR (but phusion polymerase should give very few mutations). –  Mark B May 22 '13 at 7:11
    
Most vectors do have convenient cut sites, but I can see that this is convenient in a lot of ways and it would be quick to order new oligos for the vector. i really want to try this in the lab... –  shigeta May 22 '13 at 12:35

check out the new gibson resource on the Addgene.com website https://www.addgene.org/plasmid_protocols/gibson_assembly/

Addgene has a lot of technical resources and adds more every day May also already have the plasmid you need.

share|improve this answer
1  
Please note that if you are marketing a site you are affiliated with you need to state this in your post. See here for further information. –  Rory M Jun 18 '13 at 16:59

Your Answer

 
discard

By posting your answer, you agree to the privacy policy and terms of service.

Not the answer you're looking for? Browse other questions tagged or ask your own question.