Take the 2-minute tour ×
Biology Stack Exchange is a question and answer site for biology researchers, academics, and students. It's 100% free, no registration required.

Considering that I am writing a paper for a journal, could the following phrase be understood? or should I put the 'step-by-step' way by giving numbers?

PCR Amplification and sequencing

PCR reaction for sequencing with universal primer ITS5: F: (5’TCCTCCGCTTATTGATATGC3’ and ITS4:R: (5'TCCGTAGGTGAACCTGCG C3'), including 5,8S rDNA region (White et al 1990). Amplification condition was performed in a 25 ml reaction volume and consisting of 10 µL nuclease free water, 12.5 µL Tag green master mix, 0,5 µL forward primer, 0,5 µL reverse primer, 0,5 µLDMSO, 1 µL template. Mixture solution was amplified by PCR machine (Biorad). Thermal cycle programmed for 90 seconds at 95°C as initial denaturation, followed by 35 cycles of 30 sec at 95°C for denaturation, 30 sec at 55 °C as annealing, 90 sec at 72 °C for extension, and final extension at 72 °C for 5 min. PCR products were examined by electrophoresis at 100 V for 30 minutes in a 1% (w/v) agarose gel in 1 x TAE buffer. The marker used DNA ladder 1 kb. Electrophoresis gel was soaked in ethidium bromide for 30 minutes then visualized in UV light.

share|improve this question
    
You should change your "Amplification..." sentence to remove the word "condition" and change 25 ml to 25 µL, but other than that it looks okay. Also, maybe spell out "Forward" and "Reverse" when listing your primers. –  MattDMo May 17 '13 at 16:33
    
Is Tag meant to be Taq? –  Alan Boyd May 17 '13 at 19:58
    
@MattDMo Thank you mate! –  des May 18 '13 at 6:52
    
@AlanBoyd Is there any reference as a guidance for writing a journal; cases like 'mins should be min' and 'secs should s', and other abbreviation in (micro)biology term. Should I only learn from the previous reviews/journals? Thanks. –  des May 19 '13 at 9:33
1  
@des There isn't a "correct" abbreviation for diameter - it isn't a physical unit in the same way that seconds or minutes are. However specific journals probably have their own rules - check their Style Guide. –  Alan Boyd Sep 7 '13 at 19:12

1 Answer 1

Here's my take, just a few minor changes which are shown in bold (I have also changed ,to . for decimal numbers and added a few spaces where needed):

PCR Amplification and sequencing

A PCR reaction for sequencing was performed using universal primers ITS5: F: (5’TCCTCCGCTTATTGATATGC3’) and ITS4:R: (5'TCCGTAGGTGAACCTGCG C3'), including 5.8 S rRNA region (White et al. 1990). Amplification condition was performed in a 25 ml reaction volume and consisting of 10 µL nuclease free water, 12.5 µL Taq green master mix, 0.5 µL forward primer, 0.5 µL reverse primer, 0.5 µL DMSO, 1µL template. PCR was performed using a Biorad PCR machine. The thermal cycle was programmed for 90 s at 95 °C for initial denaturation, followed by 35 cycles of 30 s at 95 °C for denaturation, 30 s at 55 °C for annealing, 90 s at 72 °C for extension, and 5 min at 72 °C for the final extension. PCR products were examined by electrophoresis at 100 V for 30 min in a 1% (w/v) agarose gel in 1 x TAE buffer. The marker used a 1 kb DNA ladder. The electrophoresis gel was soaked in ethidium bromide for 30 min then examined in UV light.

share|improve this answer
    
The first sentence is not a sentence. –  kmm May 17 '13 at 19:03
    
@terdon or even better, use the correct abbreviation for seconds which is s, not sec(s). And use min for minutes (never mins) –  Alan Boyd May 17 '13 at 19:56
    
@AlanBoyd thanks! It's 22:00 here and I'm still in my lab writing a report for a grant I received, so my mind is not at its best. I knew that sec bothered me but I couldn't put my finger on it. WHile absolutely correct, your comment about min is nicely ironic given that what I read is: "@terdon or even better, use the correct abbreviation for seconds which is s, not sec(s). And use min for minutes (not mins) – Alan Boyd 4 mins ago". :) –  terdon May 17 '13 at 20:02
    
@kmm indeed it was not. –  terdon May 17 '13 at 20:03
    
Tag should probably be Taq... –  MattDMo May 17 '13 at 20:21

Your Answer

 
discard

By posting your answer, you agree to the privacy policy and terms of service.

Not the answer you're looking for? Browse other questions tagged or ask your own question.