Take the 2-minute tour ×
Biology Stack Exchange is a question and answer site for biology researchers, academics, and students. It's 100% free, no registration required.

I'm an information technology engineer. I love biology so I research biological topics and have an interest in PCR. That's why I have decided to create a PCR machine.

Everything is done now and I want to do my first experiment to see if it works or not. I would be very happy if someone could give me any suggestions for testing it at home. Which oligo should I use for testing in the easiest way? I mean a template DNA for testing that is easy to find and extract.

share|improve this question
    
Please accept the answer that you find most suitable. –  WYSIWYG Jul 31 at 9:46

3 Answers 3

You need a genome that isn't too complex, which suggests something microbial. You also need a genome that is well-characterised : either fully- sequenced, or with lots of sequenced genes to allow you to design primers. And finally you need a readily accessible source of material for DNA extraction.

I would suggest either dried yeast, as a source of Saccharomyces cerevisiae DNA, or live yoghurt as a source of DNA from Lactobacilli. You could even try culturing something from yoghurt to get pure bacterial colonies: since these would be from a food source there should be minimal risk.

You might be tempted by one of the traditional plant sources of DNA (e.g. onions) , but it can be tricky to avoid copurifying polysaccharides which inhibit DNA-related enzymes.

Finally, if you do culture some bacteria, or even if you use dried yeast, you probably wouldn't need to actually prepare DNA at all. PCR direct from bacterial cells is widely used - the 95 C step will release sufficient DNA.

added later in response to comment by OP

I chose to follow up on Lactobacillus delbrueckii subsp. bulgaricus because I found this coming up over and over again with reference to yoghurt. If you were to test a range of yoghurts I think you could be fairly confident that this would be present.

There are 5 published genomes for different strains of the species Lactobacillus delbrueckii including subspecies bulgaricus (various strains) and lactis. How different are they? I decided to look at one gene, and lactate dehydrogenase seemed like a logical choice (it produces the lactic acid).

The complete nucleotide sequence for the lactate dehydrogenase gene from Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842 is here. If you run a BLAST from that page limiting the search to Lactobacilli (taxid 1578) you do indeed find hits to the gene from several other genomes. Here is a representative selection from the sequence alignment to the least similar of the hits:

Query  99766   CCTTCCACGCTTCTGGAGGTACTGAATTCGCCCTGGCTCAACTGGGCAACGATGCCGGTA  99825
               ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||
Sbjct  90616   CCTTCCACGCTTCTGAAGGTACTGAATTCGCCCTGGCCCAACTGGGCAACGATGCCGGTA  90675

Query  99826   TGTACGGTGCCGTTAAGATGGTTCTGTAATTTTGAATGTAAAAAAGCACCAGGCTTTTAA  99885
               ||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||
Sbjct  90676   TGTACGGTGCCGTTAAGATGGTTCTGTAATTTTGAATATAAAAAAGCACCAGACTTTTAA  90735

Query  99886   AGTCTGGTGCtttttttGTTTATCCTAAAGAGTCCAGGGTTGCCTTTATCGTCGCGGCTG  99945
               |||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||
Sbjct  90736   AGTCTGGTGCTTATTTTGTTTATTCTAAAGAGTCCAGGGTTGCCTTCATCGTCGCGGCTG  90795

Query  99946   AGGCCCGCATCTTGGCCAATTCGCTGTCATTTAACGGCAATTCCAGTACGTGGCTGATCC  100005
               ||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
Sbjct  90796   AGGCCTGCATCTTGGCCAATTCGCTGTCATTTAACGGCAATTCCAGCACGTGGCTGATTC  90855

Query  100006  CTTGTCCGTTGATGATGGCCAGGGTGCCCAGGTAGATCTCATCCTTGATCCCGTATTCCC  100065
               |||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct  90856   CTTGCCCGTTGATGATGGCCAGGGTGCCCAGATAGATCTCATCCTTGATCCCGTATTCCC  90915

Query  100066  CGTGCAATGGTGCGGAAAGAGGCAGGGCCAGGTCGTTGTTTTCCAAAATGGCCGTCACGA  100125
               |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct  90916   CGTGCAATGGCGCGGAAAGAGGCAGGGCCAGGTCGTTGTTTTCCAAAATGGCCGCCACGA  90975

Query  100126  TCTTGGCCAGCATCATGGCCACGCCATAGTAGGTTGCGCCCTTTTTGACGATAATCTCGC  100185
               |||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||
Sbjct  90976   TCTTGGCCAGCATCATGGCCACGCCATAGTAGGTCGCGCCCTTTTTGCCGATGATCTCGC  91035

As you can see, there are some differences, but there should be no problem designing primers matching both (again - this is just one part of the gene). Obviously you might wish to make an alignment for all 5 sequences, but I got the impression that at least some of the others were identical to the query, even though they are from different subspecies. These are very closely-related organisms.

In terms of your experiment, I suggest that you plan to use a range of yoghurts and/or starters as the source of template. You could even mix them, if there are constraints on your set-up.

share|improve this answer
    
Hello, thank you so much. Live yoghurt is a good idea. So i need to culture Lactobacilli from yoghurt to get pure bacterial colonies before PCR or i just need to PCR direct from live yoghurt ? –  Đức UltraSoft Jun 30 '13 at 13:47
    
I would worry that something in the yoghurt might inhibit PCR. Do you have a centrifuge? Maybe try diluting some yoghurt and then spinning out a cell pellet. This looks like the starting point. –  Alan Boyd Jun 30 '13 at 14:59
    
Or you could buy a yoghurt starter culture -might be cleaner. –  Alan Boyd Jun 30 '13 at 15:01
    
I can not sure what i buy is exactly same type of Lactobacilli because the seller don't know the scientific name of the bacterial. There are dozens type of Lactobacilli so i worry i need to design a lot of primers. –  Đức UltraSoft Jul 1 '13 at 1:53
    
"Do you have a centrifuge? Maybe try diluting some yoghurt and then spinning out a cell pellet" can you describe more about this method, i never using a centrifuge before but i can create one. How do i know where bacterial located in the tube after centrifuge (is it usually in bottom ?) and how to calculate the RPM suitable ? –  Đức UltraSoft Jul 10 '13 at 6:27

Nice project. How does your machine compare with this open source thermocycler?

Since you are probably ordering a couple of oligonucleotide DNA (primers), I would order a couple more DNA oligos that will work as your template.

Something like this:

oligo 1, primer forward. 5'-AAAAAAAAAAA-3'->
oligo 2, template        3'-TTTTTTTTTTTNNNNNNN[...]NNNNNNNNNNCCCCCCCCCC-5'
oligo 3, template        5'-AAAAAAAAAAANNNNNNN[...]NNNNNNNNNNGGGGGGGGGG-3'
oligo 4, primer reverse                                <--3'-CCCCCCCCCC-5'

This is just to give you the idea, the actual sequences should be longer, have similar GC% content, and similar t-melting. The advantage is that you reduce complexity and you are virtually void of PCR inhibitors.

You will also need some DNA polymerase. Perhaps you can borrow an aliquot from someone working in a biology lab.

share|improve this answer
    
Well, amazing idea ! But 4 oligo could make more cost than 2 oligo because i need to ship oligo from foreign country so price is an important factor in my experiment. Anyway thank you for that idea. I'm finding another way simpler than that when DNA can be found in any living organism. –  Đức UltraSoft Jun 30 '13 at 14:27
    
I think my PCR machine is cheaper, faster, special because i using a motor to bring the tube from 95 o C to 65 o C just in a few second. If you like my PCR, i wil sell it for you cheaper than the OpenPCR ;) –  Đức UltraSoft Jun 30 '13 at 14:30
    
I edited my answer: you can do PCR with two oligo without any other DNA template. This is the simplest way I think. –  Gianpaolo R Jun 30 '13 at 15:04
    
@Alan, thanks I removed from the answer. Fill in, will not be useful to test the thermocycler. –  Gianpaolo R Jun 30 '13 at 17:39
    
Hello, why you removed the edited answer ? It's look like a good idea, can it's possible if i using only 2 oligo 3'-NNNNNNNNNNNNNNNNAAAAAA-5' and 5'-TTTTTTTTNNNNNNNNNNNNNNNN-3' ? –  Đức UltraSoft Jul 1 '13 at 1:31

You are anyways going to get primers and enzymes from somewhere. The best option would be to get a plasmid from any biolab. Most of the plasmids have specific sequences like M13 promoter sequence, T7 terminator/promoter sequence etc. These are standard sequences derived form viruses, that are commonly used for primer binding sites for sequencing. Also, these primers are pretty standard and optimized for easy PCR and you can get them quite easily.

share|improve this answer
    
I agree with this entirely, but the OP said: "a template DNA for testing that is easy to find and extract" (my emphasis) –  Alan Boyd Jul 1 '13 at 10:28

Your Answer

 
discard

By posting your answer, you agree to the privacy policy and terms of service.

Not the answer you're looking for? Browse other questions tagged or ask your own question.