Deoxyribonucleic acid (DNA) is the carrier of genetic information, including for all known living organisms. The only known exceptions are RNA viruses.

learn more… | top users | synonyms

1
vote
1answer
31 views

How many nucleotides are there in the LMO1?

Dr Maris at CHOP has linked the cause of high-risk neuroblastoma to a common SNP in LMO1. How many nucleotides are there in the LMO1 gene?
2
votes
2answers
116 views

Alternatives to PCR

PCR uses cycles of heating and cooling to denature the strands, calling for special thermostable DNA polymerases. In a cell, during replication, Helicase unwinds the DNA without the requirement of ...
1
vote
3answers
99 views

Are missing limbs hereditary?

So with my basic understanding of biology, DNA can change over time. Does this mean that if one (or both) parents have something major missing (like a limb), the kid will come out without a limb? ...
0
votes
0answers
19 views

Base Excision Repair and Nucleotide Excision Repair

What's the difference between BER and NER? I understand that BER removes the improper base, while NER removes the nucleotide (including the base). However, in BER, don't repair enzymes then remove ...
0
votes
1answer
83 views

Protocol to dilute DNA step ladder?

I need to run gels that are of not the "most" importance. So I do not want to waste alot of money on step ladder. How do I dilute DNA step ladder? Is there a general procedure, for I have tried ...
3
votes
1answer
122 views

In CRISPR bacteria, how does viral genomes get integrated into the spacers of CRISPR? Also, in its use, where does Cas9 cut the DNA?

I've been out of Biology for about a year polishing my programming skills. I know CRISPR/Cas9 allows targeted 'cutting' of DNA via RNA-guidance. Few questions regarding this. Regarding to its ...
1
vote
0answers
31 views

What is the aqueous solution for DNA immobilization?

This paper Electric-field assisted immobilization and hybridization of DNA oligomers on thin-film microchips Which is talking about how the electric field improve the DNA immobilization process. ...
7
votes
1answer
204 views

Why does size decrease across the sequence of human chromosomes?

The following graph shows a decrease in the amount of base pairs per chromosome across the sequential set of human chromosomes: Is this because chromosomes were originally numbered by their size on ...
1
vote
2answers
85 views

What would be the shortest and optimal method of extracting human cells for PCR? Is there a colony PCR like protocol for human cells?

I am trying to devise a quick method to extract genomic DNA from human cells for a PCR. I first collected cells by centrifuging saline mouthwash (0.9% NaCl) and extracted genomic DNA using kit ...
1
vote
0answers
30 views

What are the reasons which make intron detection uncertain?

Intron/exon sequence detection seems to involve statistical prediction which can at best deliver a guess (until experimentally confirmed) as to where the splice site is. What are the reasons why ...
2
votes
2answers
49 views

Do eukaryote cells contain DNA that isn't part of a chromosome or located in the mitochondria?

I specify eukaryote in the title, but I'm also interested if this question isn't applicable to eukaryote cells in general but is to humans. I was reading "RNA-seq: An assessment of technical ...
1
vote
1answer
46 views

Query from a ppt slide

I came across this slide: Now I haven't understood what the last two grey colored lines mean. Can't ORFS be of any size? What is overlapping frames here?
1
vote
2answers
56 views

Does common PCR amplify genes regardless of what cells / barriers they are in?

I have some understanding of how PCR testing works. What I have always been wondering: how can we be sure that a primer reacts with the targeted gene(s) regardless of where¹ the genes are inside a ...
1
vote
1answer
33 views

Conjugated deoxyribonucleotides

I'm currently learning about using PCR techniques to make fluorescently labelled DNA probes, and the textbook mentions "conjugated deoxyribonucleotides" Can someone explain what these are? Nothing ...
0
votes
0answers
23 views

DNA replication: in which direction does the DNA polymerase 3 work?

In a couple of sites I have seen, it states that it reads in 3' to 5' direction (upstream) though the daughter strand is made in the 5'-3' direction. How does that work?
2
votes
1answer
206 views

Anomalous base pairing of nucleotide tautomers

What tautomers base pair with what bases? I know that adenine pairs with thymine and guanine pairs with cytosine normally. My question is what does the imino form of adenine base pair with? Regular ...
0
votes
0answers
29 views

Components of DNA repair and DDR

Many of the molecules involved in DNA repair, specifically Homologous Recombination, do not have clear differentiation from DNA Damage Response Pathway. What is the best journal article that makes ...
0
votes
0answers
40 views

Are there any arguments against the Onion Test

Are there are any sound arguments (that are simply explained) against the Onion test (http://www.genomicron.evolverzone.com/2007/04/onion-test/)? Which in turn could contribute to the argument that ...
1
vote
0answers
28 views

recombination between DNA segments question

In the diagram shown above, segments A and C are copies of a repeated DNA sequence, flanking a unique stretch shown as B. A and C are in an inverted orientation relative to each other, as indicated ...
1
vote
1answer
53 views

tandem repeat sequence; causes of contraction and/or expansion question

Question: Which of the following events, occurring within a tandem repeat sequence, will cause an expansion or contraction of the array? A) Endoduplication B) homologous recombination C) ...
1
vote
1answer
63 views

Is there any possible way to take a DNA test without using blood in humans?

Is there any possible way to take a DNA test without the need to draw blood in humans? Any information will be useful for me.
1
vote
1answer
42 views

Resolution of gel electrophoresis

My professor mentioned the resolution of the gel in gel electrophoresis. He stated that agarose has large pores and thus low resolution whereas polyacrylamide has the opposite. I don't understand ...
1
vote
0answers
63 views

Absorbed dose from a CT scan with relation to radiation accidents

I read somewhere that the average CTDIvol in CT scans at hospitals is ~40 mGy. This translates to the 'radiation intensity' at the center of the person, and can also be roughly interpreted as an ...
3
votes
1answer
55 views

Why do some bacteria have an asymmetric replication?

Our teacher said that Bacillus subtilis has an asymmetrical replication fork. I know that this happens only in some strain of the bacteria . She asked us to find an explication for this mechanism , ...
1
vote
0answers
31 views

How does one predict the methylation pattern?

Suppose, we have a double stranded DNA like 5' AGCTAGGAGAGACCAGGTTCC 3' 3' TCGATCCTCTCTGGTCCAAGG 5' Where would the methylated cytosine be? Is there any randomness?
0
votes
2answers
63 views

Can we change one's genome into the genome of somebody else

If I (grown-up individual and not just an egg after fertilization) wanted your exact genome, would we be able with today's technology to change my genome into yours?
2
votes
2answers
135 views

Reading and Understanding profile bands in DNA Fingerprinting

I have very limited knowledge when it comes to DNA fingerprinting. I know about the technique gel electrophoresis and how everything is carried out. But I don't know how to read the result or ...
1
vote
0answers
33 views

Since nature highly favors the pyranose forme of Ribose, what explains the fact we find it in the form of furanose in DNA and RNA?

I read in my notes that relative abundance of ribopyranose represents about 80% of all ribose in solution (including the alpha and beta anomeres). I'm curious as to why evolution favored the use of ...
2
votes
0answers
432 views

Why does supercoiled DNA run faster?

The DNA exists in linear and cirular forms. The latter form has interesting feature called Supercoiling. The more number of writhe makes it more supercoiled because of which it gets more compact. ...
4
votes
1answer
393 views

Why can't we use plasmids to add genes to ourselves?

Reading these answers I wonder, why doesn't "gene therapy" use self-contained plasmids instead of trying to splice a length into a chromosome?
8
votes
1answer
2k views

Can females be recreated from male DNA?

A chromosomal male is XY and a chromosomal female is XX. Now imagine if, one day, this world has only males - is it possible to "recreate" a female by using two X chromosomes from two different males? ...
11
votes
4answers
561 views

How did the first life form on Earth reproduce without DNA?

How did the earliest life forms exist without DNA? The most likely scenario I can think of for life happening from nothing is that, over billions of years, with trillions of water molecules and dust ...
0
votes
2answers
633 views

How do two parents, recessive and dominant genes and two complimentary nucleotides end up in one DNA? [closed]

In the basic school, I was taught that half of genome is received from father and another half comes from mother in the form of double-helix DNA, whose first helix consists of dominant nucleotide ...
6
votes
1answer
212 views

What happens after the purification step in Hi-C sequencing?

I am a statistician reading an article on Hi-C, and I am trying to better understand one of the steps in the DNA isolation and sequencing process. Since I'm a statistician, please try to avoid too ...
3
votes
1answer
133 views

How do eukaryotes terminate transcription? (clarification on Campbell Biology)

I'm having trouble understanding how eukaryotes terminate transcription. Studying Campbell Biology (pg. 342, 10th ed.), I read: In eukaryotes, RNA polymerase II transcribes the polyadenylation ...
1
vote
0answers
18 views

Using Q solution with ready made MasterMix

I am exploring the possibility of using Q solution (5x) to get rid of non specific bands in PCR. I mostly use a MasterMix and not separate aliquots of dNTPs, Taq, buffer etc. In principle, adding Q ...
2
votes
1answer
77 views

How does Cas9 interact with CRISPR?

I read that Cas9 protein along with guided RNA binds at a specific DNA fragment of foreign organism integrated in a host organism DNA. To make the host immune to virus infection Cas9 along with gRNA ...
6
votes
1answer
251 views

How can I preserve hair or saliva for future genome sequencing?

Suppose I want to preserve myself so that I can be reproduced as best as possible, in future or be simulated in future. At the moment full human genome sequencing is a bit expensive. One could get ...
2
votes
3answers
466 views

What is the biological significance of finding palindromes in DNA sequence?

I found a function called palindromes in Matlab that finds palindromes from DNA sequence. Now what is the biological intention behind incorporating this function? What the biological significance of ...
3
votes
1answer
51 views

blastn: What substitution matrix is used?

I'm currently working aligning sequences, and I need to compute similarity between pairs of DNA 'words' of a particular length. For amino acids I am able to use the substitution matrices in Biopython ...
0
votes
1answer
78 views

In the future, it is plausible that we can change the physical appearance of a living animal by editing DNA?

http://www.independent.co.uk/news/science/revealed-scientists-edit-dna-to-correct-adult-genes-and-cure-diseases-9273555.html This article explains that scientists managed to change the DNA of adult ...
0
votes
1answer
84 views

What DNA has the most info for getting a person's likeness? [closed]

I understand that DNA can come from hair but also from other places. Let's suppose a person gets their DNA mapped by a company (there are some companies claiming to offer analysis of DNA.. e.g. maybe ...
1
vote
0answers
52 views

What are constrained genetic elements?

I am somewhat of a newbie in evolutionary biology currently taking my first steps in bioinformatics. I was reading a paper when I came across the term "constrained genetic elements", referring to ...
4
votes
1answer
145 views

How does NHEJ cause indels?

I was reading up on CRISPR-cas9 and how it works and I am having trouble wrapping my head around how NHEJ to repair the DSB can cause indels to occur. Shouldn't the NHEJ just stick the two strands of ...
9
votes
1answer
1k views

Are all Y-chromosomes the same?

Since the Y-chromosome can only pass from male to male child, it would seem to pass intact. Thus, a boy's Y-chromosomes would, I guess, be the same as his father's. Going backwards, would not all men ...
0
votes
1answer
55 views

Expected dS/dN ratio for exome

I am trying to determine whether or not my sequencing data has more/less non-synonymous mutations than would be expected. My understanding is that there is some fixed ds/dn ratio for the human exome ...
1
vote
1answer
58 views

Is studying complete mitochondrial genome need biological lab work?

The research complete mitochondrial genome study done on species: Juema pig Sus scrofa (Suina: Suidae) from southern Gansu red rainbowfish speckled dace, Rhinichthys osculus white char Salvelinus ...
0
votes
0answers
30 views

Need clarification on a sentence regarding vesicle-mediated translocation

I've chanced upon a passage that is not entirely clear to me: In addition to conjugation, transformation and transduction, other less well recognised mechanisms of DNA uptake occur in nature, ...
1
vote
0answers
36 views

Why I obtain larger bands than expected after minipreparation?

guys! I made a "home made" minipreparation to obtain my plasmid+insert (totalizing approximately 6Kb). But, when I run a agarose gel, I saw a unique band with 10Kb. Why?
0
votes
1answer
91 views

difference in genetic instuctions between male and female [duplicate]

I'm a computer science graduate so please bear with me the following computer program : mov ecx, -1 INC ecx consist of 2 instructions (mov,inc) each working on specific data , can genetics ...