Deoxyribonucleic acid (DNA) is the carrier of genetic information, including for all known living organisms. The only known exceptions are RNA viruses.

learn more… | top users | synonyms

1
vote
1answer
50 views

what are examples of experimental designs on exposing materal for degradation

if one wanted to compare how sources of DNA would degradate in various conditions(environmental) how would they do this in an experimental fashion but also be best comparable to real world examples of ...
1
vote
0answers
43 views

What are the effects of non-ultraviolet light radiation on DNA?

I am trying better understand the effects of varying the frequency of light on DNA, however, most of what comes up is "UV light" and how it is damaging to DNA (presumably by ionization). Have there ...
0
votes
1answer
39 views

Can you force human body to mass produce specific proteins? [closed]

I've had difficulty finding an answer to this question on Google. From what I've been taught, DNA is used as a "naive blueprint" to synthesize proteins. If we can manipulate DNA (Which I hear we can)...
3
votes
0answers
22 views

What are flagged primers? [closed]

I'm interested in amplifying a sequence for further use with Gibson Assembly. I want to create overhang regions in my DNA fragment so there would be complementarity to the plasmid I'm trying to insert ...
1
vote
0answers
47 views

Insertion of synthetic DNA sequence

If I have some synthetic DNA sequence (<=20 bp long), is there a way for me to reliably insert this sequence next to some n-bp motif? I'd like for this to be possible in humans. If so, are there ...
7
votes
1answer
97 views

How can I generate a random DNA sequence?

I've found this paper which involves the construction of 19-bp random DNA sequences, but I don't know enough biology to understand how this method works. Could someone explain it to someone who is ...
0
votes
1answer
32 views

Time needed for transcription of DNA [closed]

How much time would it take to complete the transcription of an average-sized human gene?
5
votes
1answer
129 views

How do electrons destroy DNA bonds in radiation?

Malignant tumors can be treated by radiation therapy. Most commonly it's radiotherapy with photons, or protons and so on. The common denominator for both types is that the radiation creates electrons ...
1
vote
0answers
35 views

How do cell repair mechanism ratios change as they age?

I have seen that embryonic stem cells are shown to use homologous repair for double strand breaks rather then non-homologous end joining (NHEJ). [1] I am wondering if something also happens to a cell'...
-2
votes
1answer
76 views

Homework Question: Confused about figure related to cDNA and gDNA

what is the answer in blank? I think the loop structure for the top blank is an intron. I think RNA is the answer for the bottom blank, but it is cDNA, so it can't be RNA. I cannot figure out what ...
2
votes
1answer
125 views

Why do bacteria need messenger RNA?

Why do bacteria need mRNA? Isn't the DNA free floating without nuclear membrane so why doesn't the tRNA read the code directly off of the split DNA strands? (ofcourse after helicase splits them). ...
1
vote
1answer
39 views

Why isn't the RNA in bacteria always split up and replicating?

Isn't helicase always free floating in bacterial cells, and the DNA without a nuclear membrane and uncoiled and freefloating and so why doesn't the helicase keep breaking the double helix of DNA? Also,...
1
vote
0answers
18 views

Amputation of part of the cytoplasm of the amoeba? [closed]

We ampute a part of the cytoplasm of the amoeba many times and we observe that amoeba is not divided This experience allows to deduce the cause of the division of amoeba Do that have relation with ...
4
votes
2answers
839 views

What is the instructional language of DNA?

DNA carries most of the genetic instructions used in the development, functioning and reproduction of all known living organisms and many viruses (Wikipedia). Is it already know how ATCG's sequences ...
0
votes
1answer
43 views

How DNA programs the first cell in womb into a human [closed]

Sorry if you see me silly. I am just a programmer happens to be curious about biology... So far I understand how DNA make protein, how cell divides, how one composed of cells->tissues-> organs. But,...
2
votes
1answer
48 views

In DNA sequencing, is “mate pairs” synonymous with “paired ends”? If not, how do they differ?

By just looking at Roach et al's paper I get the impression that they are the same thing, and the Wikipedia URL for the former is a redirect to the latter. However, I suspect they are not exactly the ...
1
vote
2answers
77 views

Prader-Willi Syndrome and Angelman Syndrome?

On the website http://www.whatisepigenetics.com/fundamentals/2/ it states that the imprint disorders Prader-Willi syndrome and Angelman syndrome, display an abnormal phenotype as a result of the ...
0
votes
1answer
107 views

Difference between PCR for linear template and a plasmid?

I believe PCR can be conducted both on a linear template and a plasmid, and I was wondering how these procedures differ in what enzymes are used, how the enzymes work on the template, primers used etc....
0
votes
1answer
34 views

why dna polymerase 3 requires a primer for replication [duplicate]

Why DNA polymerase 3 needs a primer to star replication.And whats happens when there is no AUG sequence on entire DNA.
0
votes
1answer
94 views

Why do you need primers in PCR? [duplicate]

I have read that DNA polymerase requires a primer to bind to the DNA, but I am confused as to why this is the case. When DNA undergoes replication in the cell, there are no primers in the nucleus so ...
3
votes
1answer
214 views

How to perform a DNA structural alignment in pymol

How can I "fit" two DNA structures having different nucleotide sequences in pymol? I would like to use the structure of a DNA binding protein in pdb (1h9t), which is bound to DNA in the pdb file, ...
5
votes
1answer
77 views

How do mutations actually occur?

DNA replication seems so mechanical- the DNA polymerase just running along the template strand. I just don't understand how mutations can arise. When it comes to substitutions, I get that a wrong ...
1
vote
2answers
91 views

Getting PCR amplification at annealing higher than Tm!

I am amplifying a gene where in a gradient pcr i am getting amplification at an annealing temperature about 5 degrees (67) higher than Tm (62.5)? What is wrong here? Also, I am getting a very strong ...
1
vote
1answer
49 views

Can DNA base pairs go through each other? [closed]

Consider the simplified version of the motion one DNA base pair held together by a hydrogen bond: Use u and v to denote the displacements of the bases from their equilibrium position along the ...
1
vote
1answer
32 views

How many nucleotides are there in the LMO1?

Dr Maris at CHOP has linked the cause of high-risk neuroblastoma to a common SNP in LMO1. How many nucleotides are there in the LMO1 gene?
2
votes
2answers
126 views

Alternatives to PCR

PCR uses cycles of heating and cooling to denature the strands, calling for special thermostable DNA polymerases. In a cell, during replication, Helicase unwinds the DNA without the requirement of ...
1
vote
3answers
115 views

Are missing limbs hereditary?

So with my basic understanding of biology, DNA can change over time. Does this mean that if one (or both) parents have something major missing (like a limb), the kid will come out without a limb? ...
0
votes
0answers
23 views

Base Excision Repair and Nucleotide Excision Repair

What's the difference between BER and NER? I understand that BER removes the improper base, while NER removes the nucleotide (including the base). However, in BER, don't repair enzymes then remove ...
0
votes
1answer
100 views

Protocol to dilute DNA step ladder?

I need to run gels that are of not the "most" importance. So I do not want to waste alot of money on step ladder. How do I dilute DNA step ladder? Is there a general procedure, for I have tried ...
3
votes
1answer
135 views

In CRISPR bacteria, how does viral genomes get integrated into the spacers of CRISPR? Also, in its use, where does Cas9 cut the DNA?

I've been out of Biology for about a year polishing my programming skills. I know CRISPR/Cas9 allows targeted 'cutting' of DNA via RNA-guidance. Few questions regarding this. Regarding to its ...
1
vote
0answers
31 views

What is the aqueous solution for DNA immobilization?

This paper Electric-field assisted immobilization and hybridization of DNA oligomers on thin-film microchips Which is talking about how the electric field improve the DNA immobilization process. ...
7
votes
1answer
213 views

Why does size decrease across the sequence of human chromosomes?

The following graph shows a decrease in the amount of base pairs per chromosome across the sequential set of human chromosomes: Is this because chromosomes were originally numbered by their size on ...
1
vote
2answers
99 views

What would be the shortest and optimal method of extracting human cells for PCR? Is there a colony PCR like protocol for human cells?

I am trying to devise a quick method to extract genomic DNA from human cells for a PCR. I first collected cells by centrifuging saline mouthwash (0.9% NaCl) and extracted genomic DNA using kit ...
1
vote
0answers
30 views

What are the reasons which make intron detection uncertain?

Intron/exon sequence detection seems to involve statistical prediction which can at best deliver a guess (until experimentally confirmed) as to where the splice site is. What are the reasons why ...
2
votes
2answers
53 views

Do eukaryote cells contain DNA that isn't part of a chromosome or located in the mitochondria?

I specify eukaryote in the title, but I'm also interested if this question isn't applicable to eukaryote cells in general but is to humans. I was reading "RNA-seq: An assessment of technical ...
1
vote
1answer
46 views

Query from a ppt slide

I came across this slide: Now I haven't understood what the last two grey colored lines mean. Can't ORFS be of any size? What is overlapping frames here?
1
vote
2answers
60 views

Does common PCR amplify genes regardless of what cells / barriers they are in?

I have some understanding of how PCR testing works. What I have always been wondering: how can we be sure that a primer reacts with the targeted gene(s) regardless of where¹ the genes are inside a ...
1
vote
1answer
33 views

Conjugated deoxyribonucleotides

I'm currently learning about using PCR techniques to make fluorescently labelled DNA probes, and the textbook mentions "conjugated deoxyribonucleotides" Can someone explain what these are? Nothing ...
0
votes
0answers
26 views

DNA replication: in which direction does the DNA polymerase 3 work?

In a couple of sites I have seen, it states that it reads in 3' to 5' direction (upstream) though the daughter strand is made in the 5'-3' direction. How does that work?
2
votes
1answer
248 views

Anomalous base pairing of nucleotide tautomers

What tautomers base pair with what bases? I know that adenine pairs with thymine and guanine pairs with cytosine normally. My question is what does the imino form of adenine base pair with? Regular ...
0
votes
0answers
31 views

Components of DNA repair and DDR

Many of the molecules involved in DNA repair, specifically Homologous Recombination, do not have clear differentiation from DNA Damage Response Pathway. What is the best journal article that makes ...
0
votes
0answers
41 views

Are there any arguments against the Onion Test

Are there are any sound arguments (that are simply explained) against the Onion test (http://www.genomicron.evolverzone.com/2007/04/onion-test/)? Which in turn could contribute to the argument that ...
1
vote
0answers
28 views

recombination between DNA segments question

In the diagram shown above, segments A and C are copies of a repeated DNA sequence, flanking a unique stretch shown as B. A and C are in an inverted orientation relative to each other, as indicated by ...
1
vote
1answer
59 views

tandem repeat sequence; causes of contraction and/or expansion question

Question: Which of the following events, occurring within a tandem repeat sequence, will cause an expansion or contraction of the array? A) Endoduplication B) homologous recombination C) ...
1
vote
1answer
66 views

Is there any possible way to take a DNA test without using blood in humans?

Is there any possible way to take a DNA test without the need to draw blood in humans? Any information will be useful for me.
1
vote
1answer
45 views

Resolution of gel electrophoresis

My professor mentioned the resolution of the gel in gel electrophoresis. He stated that agarose has large pores and thus low resolution whereas polyacrylamide has the opposite. I don't understand ...
1
vote
0answers
64 views

Absorbed dose from a CT scan with relation to radiation accidents

I read somewhere that the average CTDIvol in CT scans at hospitals is ~40 mGy. This translates to the 'radiation intensity' at the center of the person, and can also be roughly interpreted as an '...
3
votes
1answer
61 views

Why do some bacteria have an asymmetric replication?

Our teacher said that Bacillus subtilis has an asymmetrical replication fork. I know that this happens only in some strain of the bacteria . She asked us to find an explication for this mechanism , ...
1
vote
0answers
31 views

How does one predict the methylation pattern?

Suppose, we have a double stranded DNA like 5' AGCTAGGAGAGACCAGGTTCC 3' 3' TCGATCCTCTCTGGTCCAAGG 5' Where would the methylated cytosine be? Is there any randomness?
0
votes
2answers
67 views

Can we change one's genome into the genome of somebody else

If I (grown-up individual and not just an egg after fertilization) wanted your exact genome, would we be able with today's technology to change my genome into yours?