Deoxyribonucleic acid (DNA) is the carrier of genetic information, including for all known living organisms. The only known exceptions are RNA viruses.

learn more… | top users | synonyms

1
vote
0answers
28 views

recombination between DNA segments question

In the diagram shown above, segments A and C are copies of a repeated DNA sequence, flanking a unique stretch shown as B. A and C are in an inverted orientation relative to each other, as indicated ...
1
vote
3answers
99 views

Does DNA influence death (e.g. by cell aging)

I know that we age because of errors in the cell replication process and these errors eventually leads to death. If we exclude environmental factors, are there any other factors that can cause these ...
3
votes
2answers
152 views

How distantly related are eusocial insects? Aren't members of a species much more related than 1/4, 1/2, or 3/4? [duplicate]

Possible Duplicate: How many genes do we share with our mother? I went to a lecture that talked about the behavior of social insects in terms of their relatedness of genes. For instance, ...
1
vote
1answer
63 views

Is there any possible way to take a DNA test without using blood in humans?

Is there any possible way to take a DNA test without the need to draw blood in humans? Any information will be useful for me.
1
vote
1answer
42 views

Resolution of gel electrophoresis

My professor mentioned the resolution of the gel in gel electrophoresis. He stated that agarose has large pores and thus low resolution whereas polyacrylamide has the opposite. I don't understand ...
1
vote
0answers
31 views

How does one predict the methylation pattern?

Suppose, we have a double stranded DNA like 5' AGCTAGGAGAGACCAGGTTCC 3' 3' TCGATCCTCTCTGGTCCAAGG 5' Where would the methylated cytosine be? Is there any randomness?
2
votes
2answers
137 views

Reading and Understanding profile bands in DNA Fingerprinting

I have very limited knowledge when it comes to DNA fingerprinting. I know about the technique gel electrophoresis and how everything is carried out. But I don't know how to read the result or ...
0
votes
2answers
63 views

Can we change one's genome into the genome of somebody else

If I (grown-up individual and not just an egg after fertilization) wanted your exact genome, would we be able with today's technology to change my genome into yours?
1
vote
0answers
33 views

Since nature highly favors the pyranose forme of Ribose, what explains the fact we find it in the form of furanose in DNA and RNA?

I read in my notes that relative abundance of ribopyranose represents about 80% of all ribose in solution (including the alpha and beta anomeres). I'm curious as to why evolution favored the use of ...
2
votes
0answers
436 views

Why does supercoiled DNA run faster?

The DNA exists in linear and cirular forms. The latter form has interesting feature called Supercoiling. The more number of writhe makes it more supercoiled because of which it gets more compact. ...
3
votes
2answers
150 views

Restriction sites

I would like to know: how many restriction sites does a restriction enzyme use on a DNA molecule? In other words: If a sequence on a plasmid contains the following bases: ATTGCAGTCTG and I want ...
4
votes
1answer
397 views

Why can't we use plasmids to add genes to ourselves?

Reading these answers I wonder, why doesn't "gene therapy" use self-contained plasmids instead of trying to splice a length into a chromosome?
8
votes
1answer
2k views

Can females be recreated from male DNA?

A chromosomal male is XY and a chromosomal female is XX. Now imagine if, one day, this world has only males - is it possible to "recreate" a female by using two X chromosomes from two different males? ...
0
votes
2answers
639 views

How do two parents, recessive and dominant genes and two complimentary nucleotides end up in one DNA? [closed]

In the basic school, I was taught that half of genome is received from father and another half comes from mother in the form of double-helix DNA, whose first helix consists of dominant nucleotide ...
6
votes
1answer
212 views

What happens after the purification step in Hi-C sequencing?

I am a statistician reading an article on Hi-C, and I am trying to better understand one of the steps in the DNA isolation and sequencing process. Since I'm a statistician, please try to avoid too ...
3
votes
1answer
134 views

How do eukaryotes terminate transcription? (clarification on Campbell Biology)

I'm having trouble understanding how eukaryotes terminate transcription. Studying Campbell Biology (pg. 342, 10th ed.), I read: In eukaryotes, RNA polymerase II transcribes the polyadenylation ...
7
votes
3answers
4k views

What makes DNA sticky-ends sticky?

When restriction enzymes jaggedly cut double stranded DNA it results in so called sticky ends. What is the substance that makes the DNA sticky?
1
vote
0answers
18 views

Using Q solution with ready made MasterMix

I am exploring the possibility of using Q solution (5x) to get rid of non specific bands in PCR. I mostly use a MasterMix and not separate aliquots of dNTPs, Taq, buffer etc. In principle, adding Q ...
1
vote
0answers
53 views

What are constrained genetic elements?

I am somewhat of a newbie in evolutionary biology currently taking my first steps in bioinformatics. I was reading a paper when I came across the term "constrained genetic elements", referring to ...
3
votes
1answer
51 views

blastn: What substitution matrix is used?

I'm currently working aligning sequences, and I need to compute similarity between pairs of DNA 'words' of a particular length. For amino acids I am able to use the substitution matrices in Biopython ...
0
votes
1answer
78 views

In the future, it is plausible that we can change the physical appearance of a living animal by editing DNA?

http://www.independent.co.uk/news/science/revealed-scientists-edit-dna-to-correct-adult-genes-and-cure-diseases-9273555.html This article explains that scientists managed to change the DNA of adult ...
4
votes
1answer
146 views

How does NHEJ cause indels?

I was reading up on CRISPR-cas9 and how it works and I am having trouble wrapping my head around how NHEJ to repair the DSB can cause indels to occur. Shouldn't the NHEJ just stick the two strands of ...
0
votes
1answer
84 views

What DNA has the most info for getting a person's likeness? [closed]

I understand that DNA can come from hair but also from other places. Let's suppose a person gets their DNA mapped by a company (there are some companies claiming to offer analysis of DNA.. e.g. maybe ...
9
votes
1answer
1k views

Are all Y-chromosomes the same?

Since the Y-chromosome can only pass from male to male child, it would seem to pass intact. Thus, a boy's Y-chromosomes would, I guess, be the same as his father's. Going backwards, would not all men ...
1
vote
1answer
58 views

Is studying complete mitochondrial genome need biological lab work?

The research complete mitochondrial genome study done on species: Juema pig Sus scrofa (Suina: Suidae) from southern Gansu red rainbowfish speckled dace, Rhinichthys osculus white char Salvelinus ...
0
votes
0answers
30 views

Need clarification on a sentence regarding vesicle-mediated translocation

I've chanced upon a passage that is not entirely clear to me: In addition to conjugation, transformation and transduction, other less well recognised mechanisms of DNA uptake occur in nature, ...
1
vote
0answers
36 views

Why I obtain larger bands than expected after minipreparation?

guys! I made a "home made" minipreparation to obtain my plasmid+insert (totalizing approximately 6Kb). But, when I run a agarose gel, I saw a unique band with 10Kb. Why?
6
votes
1answer
86 views

What is the fate of micronucleus DNA?

Micronuclei are cellular structures that are formed as a by-product of, usually, defective mitosis. The piece of chromosome in a micronucleus may, or may not contain a centromere and the DNA is ...
0
votes
1answer
36 views

Bioinformatics - DNA binding, sequence-specific protein data

I am a computer scientist and we are working on protein function prediction algorithms. Right now, we would like to examine protein-DNA binding properties computationaly. For this, we would make use ...
5
votes
3answers
178 views

Why does nature use a 4-level system (DNA) to encode information?

First, I am not a biologist, so this question might be naive: All of our information processing and storing is based on 2-level logic, bits with 0 and 1. Now, DNA stores the information in a 4-level ...
0
votes
1answer
75 views

Nature of Dengue Fever Genetic Material

Once the genetic material for Dengue Fever is inserted into the human DNA, would the Dengue Fever molecular material be in the form of its own isolated DNA fragment or will it be inserted directly ...
5
votes
3answers
621 views

Does the genetic material the sperm carries affect its physical properties

Basically, what I'm asking is, is the actual sperm cell built from the blueprint in the DNA of the man or is it itself also a consequence of the DNA it carries? I'd like to know a few more things ...
1
vote
2answers
42 views

Is it possible to amplify every single piece of DNA through PCR?

Is there a way to perform non-specific PCR amplification for the purpose of amplifying every piece of DNA present?
0
votes
2answers
82 views

Complexity in creating transgenic animals (e.g., mice)

Many papers I have seen describing transgenic rodent models (and presumably applicable to other model organisms) involve the knock-in, or modification to, a single gene, possibly two genes. With ...
13
votes
1answer
2k views

Solubility of DNA in water

This would seem to be an easy to answer question, but I was unable to find an answer (in g/L) for generic double-stranded DNA or plasmid neither on Google nor on BioNumbers. I would expect the ...
1
vote
2answers
59 views

Are genes on the 5' to 3' strand only?

I confused myself during studying, and wanted to confirm something. Since transcription via RNA polymerases only takes place in the 5'to 3' direction, that would mean that that 5' to 3' strand is the ...
2
votes
2answers
63 views

Organ donation compatibility based on DNA

As far as I know, multiple tests are made before organ transplant to determine matching. Would it be possible to do the matching based on the DNA of the patients, rather than the actual serum ...
1
vote
0answers
33 views

There are 6 classifications of CFTR mutations. Is a causal relationship to the sweat test known?

Cystic fibrosis (CF) is caused by mutations in the gene for the protein cystic fibrosis transmembrane conductance regulator (CFTR). The CFTR mutations are classified in 6 classes. The sweat test is ...
0
votes
0answers
67 views

Diffuse DAPI staining after time in tissue

My student is using ProLong Gold with DAPI (premixed) on sheep uterine tissue. We have used this reagent for some time with great results. Now, when she finishes her immunofluorescence protocol, ...
3
votes
1answer
55 views

Are genes uniformly dispersed throughout the genome?

I think that telomeres and centromeres are regions with a very low gene content (= regions that contain few genes). To the exception of telomeres and centromeres, are genes uniformly distributed ...
3
votes
1answer
47 views

Why would mutation rates increase in a tumour?

This article describes a tumour: Swanton found that even the primary tumour was surprisingly varied. He found 128 mutations among the various samples, but only a third of these were common to all ...
23
votes
3answers
3k views

Which organism has the smallest genome length?

Which animal/plant/anything has smallest length genome?
2
votes
1answer
86 views

Is nuclear DNA immuno-privileged?

It is well known that if DNA occurs in the cytoplasm of eukaryotic cells, an immune response may be triggered through a myriad of DNA receptors and pathways as part of the immuno response. Yet, ...
2
votes
1answer
106 views

Specific numbers of nucleotides in Okazaki fragments

Okazaki fragments are formed during replication of the lagging DNA strand. What determines the length of these fragments?
2
votes
1answer
852 views

Why are nitrogenous bases of DNA hydrophobic if they can hydrogen bond?

Why are nitrogenous bases of DNA hydrophobic if they can hydrogen bond? Is it that they are only relatively hydrophobic? This forum explains it but does not give an example of the structure.
14
votes
8answers
2k views

Is there a biological mechanism for evolution encoded into our DNA?

Throughout high school, I remember learning about Darwin's theory of evolution as if it were near-fact. But something always seemed wrong about the ideas presented. Survival of the fittest Random ...
2
votes
0answers
71 views

What happens when a genome is shorter than the other? [closed]

Say there were 2 creatures of the same species. Creature 1 has a longer genome than creature 2, it may be just a few base pairs, but what would happen when the genes were crossed to create creature 3 ...
0
votes
2answers
114 views

What is the DNA Sequence for an apple?

The title says it all. I'm just curious. I read that scientists mapped the genome for Malus Domestica, but I can't find a sequence anywhere.If this is a stupid question, I would appreciate if you tell ...
9
votes
1answer
108 views

Evolution of the Redundancy of the Genetic Code

In short Looking at the genetic code, it appears that most redundancy is on the third letter rather than on the first or the second letter of the codon. Why has it evolved this way? Longer version ...
1
vote
1answer
94 views

Is each generation getting older? [duplicate]

So we know that our sperm and egg cells get set aside relatively early so that they aren't going through unnecessary cell divisions and causing DNA damage or telomere shortening, but since each new ...