Deoxyribonucleic acid (DNA) is the carrier of genetic information, including for all known living organisms. The only known exceptions are RNA viruses.

learn more… | top users | synonyms

3
votes
0answers
79 views

How to calculate information content of a DNA sequence

How does one calculate the information content of DNA sequence like ATCGGCT where mutation rate of G's is 10% and the most common mutation product binds with C and A with equal frequency. I know that ...
3
votes
0answers
33 views

Minichromosome maintenance protein structure and function

I am having difficulty answering three homework questions which relate directly to Chong et al. (2000). Questions The authors have determined that MtMCM is able to bind both ssDNA and dsDNA (see ...
3
votes
0answers
26 views

Do eukaryotes assimilate DNA that is floating in the extracellular membrane?

Prokayotes, which replicate primarily using binary fission, don't get much genetic diversity. For this reason, they take in any genetic material they encounter, in a gambit to help them better adapt ...
3
votes
0answers
121 views

How stable is linear DNA transfected in eukaryotic cells?

I would like to know, with references from the literature, what is the half life of a linear dsDNA transfected in a mammalian cells. For example, if I transfect human cells with a PCR product ...
3
votes
0answers
24 views

Inter-codon mutations statistical analysis

I am looking for a statistical approach to inter-codon mutations. For example a 64*64 (64*63 actually) table, that contain the possibility of mutation from one codon to another codon (CCA to CAA or ...
3
votes
0answers
31 views

Gibson assembly - primer design with A and T rich regions

I have question about Gibson assembly. I have done it several times and it always worked okay for us, but now I want to assemble together a fragment which has sequence like this: ...
2
votes
0answers
478 views

Why does supercoiled DNA run faster?

The DNA exists in linear and cirular forms. The latter form has interesting feature called Supercoiling. The more number of writhe makes it more supercoiled because of which it gets more compact. ...
2
votes
0answers
75 views

CRISPR-Cas Systems

In the context of the bacterial systems (not the gene editing tool), I was wondering what happens to the foreign DNA after the Cas proteins have created a new spacer. It is really not clear to me, ...
2
votes
0answers
86 views

Can DNA test of my grandparent's brother reveal my heritage from that branch of the family?

I'm thinking about doing that DNA test on all my grandparents to know where their genes come from. They are getting very old and I don't want to let the opportunity pass to gather more knowledge about ...
2
votes
0answers
39 views

Link between macro lncRNA and DNA looping

I was wondering if anybody knows some publication about macro lncRNA (very long unspliced RNAs) or more generally a transcribed RNA that may lead to cis-DNA looping of genomic regions overlapped by ...
1
vote
0answers
27 views

Estimating RNA concentration from Specific Activity of Labeled RNA

The question reads, Using T7 RNA polymerase to transcribe in vitro a 100-nt RNA off a DNA template. This RNA contains 19 Adenosines. In your 100 uL transcription reaction you added 1.00 µL of ...
1
vote
0answers
30 views

From an information perspective, are both strands of DNA necessary?

I am learning about the genetic code, replication, and transcription, and I have a question about whether or not both strands of DNA are really "necessary". In replication, at a high level, we are ...
1
vote
0answers
175 views

Construct a restriction map of a linear fragment of DNA using the following data?

I've attempted to do the single digests, and the double digests, but cannot complete the map.... I've attached what I've done so far DNA Sizes of Fragments (bp) uncut DNA 900 DNA cut with EcoRI ...
1
vote
0answers
26 views

Hydrogen bonding and the blocking thereof in nucleic acids during nuclear processes

In transcription, RNA polymerase unwinds the DNA double helix and begins attaching RNA nucleotides to the template strand. In its wake, the DNA double helix closes back—this is only natural, seeing as ...
1
vote
0answers
23 views

Infer type of nucleic acid based on number of nucleosides

Lets say we analysed a nucleic acid and found out that it had 20% Adenosine, 25% Guanosine, 40% Thymine and 15% Cytosine. We know that A always pairs with T and G with C. So, based on these numbers, ...
1
vote
0answers
41 views

Was the frequency of mutations more during primitive earth due to radioactivity?

Primitive earth was more radioactive (or was it really?) according to radiometric analysis of C14 which suddenly appeared at 4250 million years in the Hadeon eon. Is it possible that ancient high ...
1
vote
0answers
31 views

Is DNA transcription inactive during mitosis ie no proteins are made? How does the cell survive?

I've read that during mitosis, DNA exists as heterochromatin, a form that is unable to be accessed for transcription. Does this mean no new proteins are made during what can be 20% of a cell's life? ...
1
vote
0answers
11 views

Where can one find completed and processed Hi-C datasets?

I and a statistics graduate student at UCR, and I am working on Optimal Binning schemes and peak detection in Hi-C data analysis (a dataset that conveys information about proximity of a DNA strand ...
1
vote
0answers
11 views

final control prior to transfecting an expression vector into a mammalian cell?

I have been asked a general question: Once I have cloned a full-length cDNA into an expression vector, what final important control must I do before I transfect this into an embryonic stem cell line? ...
1
vote
0answers
68 views

Which DNA fragments do not have expected sizes on this gel electrophoresis?

The problem is such: After performing a PCR, the vector carrying the PCR fragment with two restriction enzymes (Nhe1 and Asc1). The DNA samples were then separated using agrose gel electrophoresis ...
1
vote
0answers
42 views

What are the effects of non-ultraviolet light radiation on DNA?

I am trying better understand the effects of varying the frequency of light on DNA, however, most of what comes up is "UV light" and how it is damaging to DNA (presumably by ionization). Have there ...
1
vote
0answers
46 views

Insertion of synthetic DNA sequence

If I have some synthetic DNA sequence (<=20 bp long), is there a way for me to reliably insert this sequence next to some n-bp motif? I'd like for this to be possible in humans. If so, are there ...
1
vote
0answers
35 views

How do cell repair mechanism ratios change as they age?

I have seen that embryonic stem cells are shown to use homologous repair for double strand breaks rather then non-homologous end joining (NHEJ). [1] I am wondering if something also happens to a ...
1
vote
0answers
31 views

What is the aqueous solution for DNA immobilization?

This paper Electric-field assisted immobilization and hybridization of DNA oligomers on thin-film microchips Which is talking about how the electric field improve the DNA immobilization process. ...
1
vote
0answers
30 views

What are the reasons which make intron detection uncertain?

Intron/exon sequence detection seems to involve statistical prediction which can at best deliver a guess (until experimentally confirmed) as to where the splice site is. What are the reasons why ...
1
vote
0answers
28 views

recombination between DNA segments question

In the diagram shown above, segments A and C are copies of a repeated DNA sequence, flanking a unique stretch shown as B. A and C are in an inverted orientation relative to each other, as indicated ...
1
vote
0answers
64 views

Absorbed dose from a CT scan with relation to radiation accidents

I read somewhere that the average CTDIvol in CT scans at hospitals is ~40 mGy. This translates to the 'radiation intensity' at the center of the person, and can also be roughly interpreted as an ...
1
vote
0answers
31 views

How does one predict the methylation pattern?

Suppose, we have a double stranded DNA like 5' AGCTAGGAGAGACCAGGTTCC 3' 3' TCGATCCTCTCTGGTCCAAGG 5' Where would the methylated cytosine be? Is there any randomness?
1
vote
0answers
34 views

Since nature highly favors the pyranose forme of Ribose, what explains the fact we find it in the form of furanose in DNA and RNA?

I read in my notes that relative abundance of ribopyranose represents about 80% of all ribose in solution (including the alpha and beta anomeres). I'm curious as to why evolution favored the use of ...
1
vote
0answers
18 views

Using Q solution with ready made MasterMix

I am exploring the possibility of using Q solution (5x) to get rid of non specific bands in PCR. I mostly use a MasterMix and not separate aliquots of dNTPs, Taq, buffer etc. In principle, adding Q ...
1
vote
0answers
60 views

What are constrained genetic elements?

I am somewhat of a newbie in evolutionary biology currently taking my first steps in bioinformatics. I was reading a paper when I came across the term "constrained genetic elements", referring to ...
1
vote
0answers
37 views

Why I obtain larger bands than expected after minipreparation?

guys! I made a "home made" minipreparation to obtain my plasmid+insert (totalizing approximately 6Kb). But, when I run a agarose gel, I saw a unique band with 10Kb. Why?
1
vote
0answers
33 views

There are 6 classifications of CFTR mutations. Is a causal relationship to the sweat test known?

Cystic fibrosis (CF) is caused by mutations in the gene for the protein cystic fibrosis transmembrane conductance regulator (CFTR). The CFTR mutations are classified in 6 classes. The sweat test is ...
1
vote
0answers
52 views

Nutritious protein substance for vitamin enhanced crop?

I am not a bio or science major, but we have a subject, like an elective on biotechnology and we were tasked to think of a product that hasn't been invented yet. My groupmates and I thought of a ...
1
vote
0answers
129 views

Transfect Mammalian Cells with Single Stranded DNA?

Agrobacteria can deliver parts of their DNA to plant cells as T-DNA, transfer DNA. This DNA is delivered as a single strand and can be integrated into the plant genome or can be converted to a double ...
1
vote
0answers
42 views

Superpatients for Cancer resistance

I was reading an article on MIT Technology review about superpatients for low cholesterol that got me thinking whether such patients exist for cancer. The article is ...
1
vote
0answers
32 views

condensed protocol for sequencing a portion of human DNA from buccal sample

Anyone have a short & sweet protocol for PCR amplifying a region of human DNA (chromosomal or mt, I don't care) extracted from a buccal sample: including validated primer sequences and preferred ...
1
vote
0answers
17 views

Phylogentic Footprinting Project

I'm working on performing phylogentic footprinting to figure out how many TRE sequences there are in the TWIST1 gene. (Sequence motifs). I'm trying to use ENSEMBL to gather orthologues of species in ...
1
vote
0answers
62 views

DNA fingerprinting

I would like to make my own DNA fingerprint - just for fun to have my "autoportrait":). I was looking around a bit and all the commercial kits you can have are very expensive. Can you suggest me a ...
1
vote
0answers
234 views

Transcription takes place from the 5’ to the 3’ end of the m-RNA. Why?

Only one side of the DNA ladder is copied (the sense side). The sense side starts with a 3’ end. This means the corresponding mRNA will have to assemble starting from the 5’ end. This is my initial ...
1
vote
0answers
35 views

what are hyperbranched amplicons in DNA sequencing?

I am reading an article about single-cell sequencing: http://www.nature.com/nbt/journal/vaop/ncurrent/full/nbt.2720.html And came across the concept of "hyperbranched amplicons". I googled for it but ...
1
vote
0answers
93 views

3' or 5' DNA capping protein

Does anyone know of a protein/molecule that can be attached to one end of the DNAs temporarily ? eg. i would like to only to allow one strand of DNA be ligated to another DNA molecule to either it's ...
0
votes
0answers
30 views

Determine OTU identity using Blastn full database or organism specific database?

I am seeking opinions on the best way to determine OTU identity using Blastn. Would the best way to identify an OTU be to blast the OTU to the full nr/nt Nucleotide collection or to blast your OTU to ...
0
votes
0answers
17 views

Strand directed mismatch repair system?

In SDM (strand directed mismatch repair), random correction of DNA (correction of template strand) is not right. For example if G (from template strand) gets joined with the T (it should have actually ...
0
votes
0answers
25 views

Color of DNA, available absorption energy levels of DNA molecule, mutations

I have done a couple of DNA separations and observe that the clumped strands of DNA are white. Is that an artifact of the chemicals used in standard separations? Or is it indeed the case that the DNA ...
0
votes
0answers
21 views

Separate replication origin and terminus vs making them one and the same

The classical picture of bacterial reproduction has a replication origin on one side of the circular chromosome and a replication termination area on the opposite end. This essentially creates two ...
0
votes
0answers
24 views

Transgenic Plant-Gene source for introduction into host organism

Let's say the plant-gene itself is known, i.e. the exact neucleotide sequence is available in a gene bank (originally sequenced from a tree sample extracted RNA). Previous work has already successfuly ...
0
votes
0answers
22 views

Base Excision Repair and Nucleotide Excision Repair

What's the difference between BER and NER? I understand that BER removes the improper base, while NER removes the nucleotide (including the base). However, in BER, don't repair enzymes then remove ...
0
votes
0answers
24 views

DNA replication: in which direction does the DNA polymerase 3 work?

In a couple of sites I have seen, it states that it reads in 3' to 5' direction (upstream) though the daughter strand is made in the 5'-3' direction. How does that work?
0
votes
0answers
30 views

Components of DNA repair and DDR

Many of the molecules involved in DNA repair, specifically Homologous Recombination, do not have clear differentiation from DNA Damage Response Pathway. What is the best journal article that makes ...