Deoxyribonucleic acid (DNA) is the carrier of genetic information, including for all known living organisms. The only known exceptions are RNA viruses.

learn more… | top users | synonyms

5
votes
1answer
166 views

How can I preserve hair or saliva for future genome sequencing?

Suppose I want to preserve myself so that I can be reproduced as best as possible, in future or be simulated in future. At the moment full human genome sequencing is a bit expensive. One could get ...
1
vote
1answer
18 views

BWA-MEM single strand or doublestrand alignment

In whole genome secondary analysis does BWA-MEM use a double stranded fasta reference or are reads aligned to only one, single stranded fasta reference?
1
vote
1answer
22 views

DNA Topology. Question on twists and writhes

Hi guys there is a question which has been driving me crazy ever since I saw this video(https://youtu.be/az2c6UbEdug). At 4:50 the guy says that when a right-handed circular DNA starts forming a right ...
7
votes
0answers
129 views

DNA-DNA cross-linking with formaldehyde?

The 3C (chromosome conformation capture) technology for studying chromatin 3D organization starts by a cross-linking step using formaldehyde to find segments of DNA interacting. In my understanding ...
3
votes
0answers
76 views

How stable is linear DNA transfected in eukaryotic cells?

I would like to know, with references from the literature, what is the half life of a linear dsDNA transfected in a mammalian cells. For example, if I transfect human cells with a PCR product ...
3
votes
0answers
29 views

Gibson assembly - primer design with A and T rich regions

I have question about Gibson assembly. I have done it several times and it always worked okay for us, but now I want to assemble together a fragment which has sequence like this: ...
2
votes
0answers
186 views

Why does supercoiled DNA run faster?

The DNA exists in linear and cirular forms. The latter form has interesting feature called Supercoiling. The more number of writhe makes it more supercoiled because of which it gets more compact. ...
2
votes
0answers
66 views

CRISPR-Cas Systems

In the context of the bacterial systems (not the gene editing tool), I was wondering what happens to the foreign DNA after the Cas proteins have created a new spacer. It is really not clear to me, ...
2
votes
0answers
80 views

Can DNA test of my grandparent's brother reveal my heritage from that branch of the family?

I'm thinking about doing that DNA test on all my grandparents to know where their genes come from. They are getting very old and I don't want to let the opportunity pass to gather more knowledge about ...
2
votes
0answers
34 views

Link between macro lncRNA and DNA looping

I was wondering if anybody knows some publication about macro lncRNA (very long unspliced RNAs) or more generally a transcribed RNA that may lead to cis-DNA looping of genomic regions overlapped by ...
2
votes
0answers
24 views

Inter-codon mutations statistical analysis

I am looking for a statistical approach to inter-codon mutations. For example a 64*64 (64*63 actually) table, that contain the possibility of mutation from one codon to another codon (CCA to CAA or ...
1
vote
0answers
37 views

How many Watson-Crick + Hoogsteen triple base pair combinations are there?

Are these triple base pairs the only Watson-Crick + Hoogsteen triple base pairs possible? Furthermore, are TAA and TAT mixed up? This image is from Wikipedia, so it's possible that it's erroneous.
1
vote
0answers
22 views

Is DNA transcription inactive during mitosis ie no proteins are made? How does the cell survive?

I've read that during mitosis, DNA exists as heterochromatin, a form that is unable to be accessed for transcription. Does this mean no new proteins are made during what can be 20% of a cell's life? ...
1
vote
0answers
7 views

Where can one find completed and processed Hi-C datasets?

I and a statistics graduate student at UCR, and I am working on Optimal Binning schemes and peak detection in Hi-C data analysis (a dataset that conveys information about proximity of a DNA strand ...
1
vote
0answers
43 views

Which DNA fragments do not have expected sizes on this gel electrophoresis?

The problem is such: After performing a PCR, the vector carrying the PCR fragment with two restriction enzymes (Nhe1 and Asc1). The DNA samples were then separated using agrose gel electrophoresis ...
1
vote
0answers
42 views

Insertion of synthetic DNA sequence

If I have some synthetic DNA sequence (<=20 bp long), is there a way for me to reliably insert this sequence next to some n-bp motif? I'd like for this to be possible in humans. If so, are there ...
1
vote
0answers
31 views

What is the aqueous solution for DNA immobilization?

This paper Electric-field assisted immobilization and hybridization of DNA oligomers on thin-film microchips Which is talking about how the electric field improve the DNA immobilization process. ...
1
vote
0answers
29 views

What are the reasons which make intron detection uncertain?

Intron/exon sequence detection seems to involve statistical prediction which can at best deliver a guess (until experimentally confirmed) as to where the splice site is. What are the reasons why ...
1
vote
0answers
28 views

Since nature highly favors the pyranose forme of Ribose, what explains the fact we find it in the form of furanose in DNA and RNA?

I read in my notes that relative abundance of ribopyranose represents about 80% of all ribose in solution (including the alpha and beta anomeres). I'm curious as to why evolution favored the use of ...
1
vote
0answers
140 views

How did the first life form on Earth reproduce without DNA?

So, the best explanation I can think of for the first life form, life happening from nothing (wow), is that over billions of years, with trillions of water molecules and dust particles and chemicals ...
1
vote
0answers
42 views

What are constrained genetic elements?

I am somewhat of a newbie in evolutionary biology currently taking my first steps in bioinformatics. I was reading a paper when I came across the term "constrained genetic elements", referring to ...
1
vote
0answers
30 views

There are 6 classifications of CFTR mutations. Is a causal relationship to the sweat test known?

Cystic fibrosis (CF) is caused by mutations in the gene for the protein cystic fibrosis transmembrane conductance regulator (CFTR). The CFTR mutations are classified in 6 classes. The sweat test is ...
1
vote
0answers
49 views

Nutritious protein substance for vitamin enhanced crop?

I am not a bio or science major, but we have a subject, like an elective on biotechnology and we were tasked to think of a product that hasn't been invented yet. My groupmates and I thought of a ...
1
vote
0answers
84 views

Transfect Mammalian Cells with Single Stranded DNA?

Agrobacteria can deliver parts of their DNA to plant cells as T-DNA, transfer DNA. This DNA is delivered as a single strand and can be integrated into the plant genome or can be converted to a double ...
1
vote
0answers
39 views

Superpatients for Cancer resistance

I was reading an article on MIT Technology review about superpatients for low cholesterol that got me thinking whether such patients exist for cancer. The article is ...
1
vote
0answers
32 views

condensed protocol for sequencing a portion of human DNA from buccal sample

Anyone have a short & sweet protocol for PCR amplifying a region of human DNA (chromosomal or mt, I don't care) extracted from a buccal sample: including validated primer sequences and preferred ...
1
vote
0answers
17 views

Phylogentic Footprinting Project

I'm working on performing phylogentic footprinting to figure out how many TRE sequences there are in the TWIST1 gene. (Sequence motifs). I'm trying to use ENSEMBL to gather orthologues of species in ...
1
vote
0answers
60 views

DNA fingerprinting

I would like to make my own DNA fingerprint - just for fun to have my "autoportrait":). I was looking around a bit and all the commercial kits you can have are very expensive. Can you suggest me a ...
1
vote
0answers
190 views

Transcription takes place from the 5’ to the 3’ end of the m-RNA. Why?

Only one side of the DNA ladder is copied (the sense side). The sense side starts with a 3’ end. This means the corresponding mRNA will have to assemble starting from the 5’ end. This is my initial ...
1
vote
0answers
31 views

what are hyperbranched amplicons in DNA sequencing?

I am reading an article about single-cell sequencing: http://www.nature.com/nbt/journal/vaop/ncurrent/full/nbt.2720.html And came across the concept of "hyperbranched amplicons". I googled for it but ...
1
vote
0answers
82 views

3' or 5' DNA capping protein

Does anyone know of a protein/molecule that can be attached to one end of the DNAs temporarily ? eg. i would like to only to allow one strand of DNA be ligated to another DNA molecule to either it's ...
0
votes
0answers
19 views

Transgenic Plant-Gene source for introduction into host organism

Let's say the plant-gene itself is known, i.e. the exact neucleotide sequence is available in a gene bank (originally sequenced from a tree sample extracted RNA). Previous work has already successfuly ...
0
votes
0answers
10 views

final control prior to transfecting an expression vector into a mammalian cell?

I have been asked a general question: Once I have cloned a full-length cDNA into an expression vector, what final important control must I do before I transfect this into an embryonic stem cell line? ...
0
votes
0answers
39 views

What are the effects of non-ultraviolet light radiation on DNA?

I am trying better understand the effects of varying the frequency of light on DNA, however, most of what comes up is "UV light" and how it is damaging to DNA (presumably by ionization). Have there ...
0
votes
0answers
28 views

How do cell repair mechanism ratios change as they age?

I have seen that embryonic stem cells are shown to use homologous repair for double strand breaks rather then non-homologous end joining (NHEJ). [1] I am wondering if something also happens to a ...
0
votes
0answers
14 views

Base Excision Repair and Nucleotide Excision Repair

What's the difference between BER and NER? I understand that BER removes the improper base, while NER removes the nucleotide (including the base). However, in BER, don't repair enzymes then remove ...
0
votes
0answers
20 views

DNA replication: in which direction does the DNA polymerase 3 work?

In a couple of sites I have seen, it states that it reads in 3' to 5' direction (upstream) though the daughter strand is made in the 5'-3' direction. How does that work?
0
votes
0answers
22 views

Components of DNA repair and DDR

Many of the molecules involved in DNA repair, specifically Homologous Recombination, do not have clear differentiation from DNA Damage Response Pathway. What is the best journal article that makes ...
0
votes
0answers
38 views

Are there any arguments against the Onion Test

Are there are any sound arguments (that are simply explained) against the Onion test (http://www.genomicron.evolverzone.com/2007/04/onion-test/)? Which in turn could contribute to the argument that ...
0
votes
0answers
27 views

recombination between DNA segments question

In the diagram shown above, segments A and C are copies of a repeated DNA sequence, flanking a unique stretch shown as B. A and C are in an inverted orientation relative to each other, as indicated ...
0
votes
0answers
58 views

Absorbed dose from a CT scan with relation to radiation accidents

I read somewhere that the average CTDIvol in CT scans at hospitals is ~40 mGy. This translates to the 'radiation intensity' at the center of the person, and can also be roughly interpreted as an ...
0
votes
0answers
27 views

How does one predict the methylation pattern?

Suppose, we have a double stranded DNA like 5' AGCTAGGAGAGACCAGGTTCC 3' 3' TCGATCCTCTCTGGTCCAAGG 5' Where would the methylated cytosine be? Is there any randomness?
0
votes
0answers
13 views

Using Q solution with ready made MasterMix

I am exploring the possibility of using Q solution (5x) to get rid of non specific bands in PCR. I mostly use a MasterMix and not separate aliquots of dNTPs, Taq, buffer etc. In principle, adding Q ...
0
votes
0answers
29 views

Need clarification on a sentence regarding vesicle-mediated translocation

I've chanced upon a passage that is not entirely clear to me: In addition to conjugation, transformation and transduction, other less well recognised mechanisms of DNA uptake occur in nature, ...
0
votes
0answers
27 views

Why I obtain larger bands than expected after minipreparation?

guys! I made a "home made" minipreparation to obtain my plasmid+insert (totalizing approximately 6Kb). But, when I run a agarose gel, I saw a unique band with 10Kb. Why?
0
votes
0answers
44 views

Diffuse DAPI staining after time in tissue

My student is using ProLong Gold with DAPI (premixed) on sheep uterine tissue. We have used this reagent for some time with great results. Now, when she finishes her immunofluorescence protocol, ...
0
votes
0answers
53 views

Does bromophenol blue cause a shadow on agarose gels stained with SYBR Gold?

Bromophenol blue in loading dye is known to cast shadows/absorb emitted light signal from DNA on Ethidium bromide gels during imaging. But if SYBR Gold is instead used as the nucleic acid stain, does ...
0
votes
0answers
71 views

Can these “Promega Wizard genomic DNA Purification kit” be used for samples not stated directly?

I am not sure if this is a duplicate of my previous question, it is somewhat related, so sorry if I misunderstood. The question is, can i use the above kit for samples like hair, fingernails, etc? ...
0
votes
0answers
14 views

What is the Magnitude of Nonspecific Oligo Binding at Low Temperatures

I am working on designing a protocol to capture genomic sequencing bound oligos (the part in question is identical to primer binding of genomic DNA during a PCR reaction). I'm wondering if anyone can ...
0
votes
0answers
82 views

Known ways to modify the genetic structure of the 13 loci used in CODIS

After reading the answer to Does our DNA change during our lives?, I was wondering if and how it would be possible to change the structure of the 13 loci that are used in the CODIS database, in such a ...