Mechanisms for inheriting phenotype outside of the genomic DNA sequence.

learn more… | top users | synonyms

3
votes
0answers
38 views

Does the bending of a tree's trunk in the wind stimulate and strengthen root growth?

Recently Southern California experienced extreme wind velocities and afterwards the news reported over 300 trees had fallen in San Diego County. I had either heard or read somewhere that the action of ...
2
votes
0answers
37 views

Epigenetics and serotonin?

In this article http://www.nature.com/neuro/journal/v17/n9/full/nn.3778.html it states that Increased promoter methylation of the serotonin transporter gene predicted increased threat related ...
2
votes
0answers
128 views

Does the Jungian notion of collective unconsciousness have any legitimacy in the light of modern neurobiology and epigenetics?

Carl Jung has long ago proposed a rather controversial notion of collective unconsciousness [1, 2, 3], a form of the unconscious (that part of the mind containing memories and impulses of which ...
2
votes
0answers
41 views

If a receptor is inhibited throughout embryogenesis, could there be observable phenotypic differences in the adult?

So I read a journal article entitled "Maternal hypoxia and caffeine exposure depress fetal CV function during primary organogenesis" (Momoi, et al., 2012) and in essence the article speaks of the ...
1
vote
0answers
31 views

How does one predict the methylation pattern?

Suppose, we have a double stranded DNA like 5' AGCTAGGAGAGACCAGGTTCC 3' 3' TCGATCCTCTCTGGTCCAAGG 5' Where would the methylated cytosine be? Is there any randomness?
1
vote
0answers
129 views

How does geography affect morphological features of the human body

I've seen many times how a person born in one place, goes to another country for a long time, and then they start looking more like the people there, but I never found out how it works. This report ...
0
votes
0answers
15 views

How effective will the synthesized virus be without epigenetic marks?

Will a de-novo synthesize infectious virus be as effective as the natural one? How important are epigenetic marks for the virus and is there a mechanism to restore them?
0
votes
0answers
22 views

How some Epigenetics characters can potentially be passed down through the generations

The (sperm +ovum)zygote is totipotent stell cell means all genes of the zygote's DNA are "on"state that can be switched off by differentiation process converting specific cells with different Jobs.So ...
0
votes
0answers
16 views

Where can I find epigenetics related microarray dataset for Alzheimer and Parkinson diseases?

In my thesis project, one of the tasks regards co-expression network analysis for epigenetics (methylation) data. In GEO and Array Express repositories, I have already searched for the microarray ...
0
votes
0answers
23 views

Relationship between selection coefficient and frequency of elimination

I'm asking this question because I would like to model the influence of changes that take place during tumour evolution to estimate what changes are selected against. I am in effect looking at ...
0
votes
0answers
25 views

Function and Mechanism of Height Genes

I have an inquiry regarding the exact function of height genes. To my knowledge, although they are heavily regulated by epigenetic factors, height genes can have either an "on" or an "off" allele, ...
0
votes
0answers
39 views

What is the gene regulation behind human adaptation to higher altitudes and therefore higher hemoglobin levels?

Some people in the Amazonian forest and in Himalayan mountains have reported living perfectly with extremely high levels of hemoglobin. I was wondering what type of gene regulation goes on in order ...