The study of the molecular processes of the nucleus and cell function.

learn more… | top users | synonyms

2
votes
1answer
89 views

What is the molecular mechanism of odorant transduction signaling pathway?

I have read a few papers on the topic of odorant signaling pathway. The following papers are listed as examples. However, I found that there is not a clear pathway representation of the odorant ...
0
votes
0answers
27 views

Wash adsorbed protein without destroying Biotin-Avidin-Mechanism

I am looking for reliable protocols to wash protein (e.g. Fibronectin) adsorbed onto glass surfaces. According to Protein immobilization literature, people usually use 1% SDS and some incubation time. ...
0
votes
1answer
32 views

Conjugated deoxyribonucleotides

I'm currently learning about using PCR techniques to make fluorescently labelled DNA probes, and the textbook mentions "conjugated deoxyribonucleotides" Can someone explain what these are? Nothing ...
2
votes
1answer
2k views

Complementarity Determining Regions (CDRs)

Complementarity determining regions (CDRs) are part of the variable domains in immunoglobulins (antibodies) and T cell receptors, generated by B-cells and T-cells respectively, where these molecules ...
1
vote
1answer
103 views

What is the reason for having an extra recognition site for a restriction enzyme?

Can the size of a supercoiled plasmid DNA be determined by using standard DNA size fragment electrophoresed in parallel? 2. An unknown DNA molecule was cleaved using several restriction enzymes ...
1
vote
0answers
21 views

If two different diseases have more than one common pathway, the relationship between their occurences?

I just wonder that are there any special relationship between the pathway and disease occurrence. For example, there are cancer A and cancer B (and they have more than one common pathway). Then if ...
1
vote
1answer
27 views

Refer to Ran-GEF as a coenzyme?

Ran-GEF facilitates an exchange of GDP for GTP in the formation of Ran-GTP in the nucleus as part of gated import of proteins. Would I be correct in calling Ran-GEF or Ran-GAP coenzymes?
0
votes
1answer
49 views

On which amino-acids residue is the SDS acting on?

I would like to know exactly what is the mechanisme of the SDS, and I would like to know on which amino-acids residue the SDS is acting on. Can you help me please ? Thank you in advance !
2
votes
1answer
55 views

How does one insert cas9 into animal cells?

How could cas9 be inserted into cells by researchers looking to edit a genome? I imagine for engineering bacterial systems you could just put in the cas9 coding region in an expression vector, but is ...
3
votes
1answer
51 views

How to predict a mRNA secondary structure with a large sequence?

When I use some web servers to predict a mRNA secondary structure, I find they always required in a small size sequence. If I use a long sequence and cut it into small parts, do these small parts ...
1
vote
1answer
33 views

What is the attacking mechanism of RF on IgG?

Rheumatoid Factor (RF) attacks Fc portion of Immunoglobulin G (IgG), I want to know the underlying mechanism at molecular level. Also, what type of bond or attachment is made by RF and Fc portion of ...
0
votes
1answer
33 views

Producing a genetically modified animal with cell walls [closed]

I'm curious if there has been any genetic experiments transferring cell wall producing genes into the genome of a animal model organism such as the fruit fly (Drosophila melanogaster) or a larger ...
1
vote
0answers
21 views

How do molecular recognition features work?

The occurrence of relatively short (10–70 residues), loosely structured protein regions bind within longer, largely disordered sequences that were characterized as bound to larger proteins. These ...
0
votes
0answers
26 views

Is there a better lysis buffer than this for fungal DNA extraction?

I've being using this lysis buffer for fungal DNA extraction,lysis buffer - 400mM TRis-HCl(pH8.0), 60mM EDTA(pH8.0), 150mM NaCl, 1% SDS and containing 40microgram/ml RnaseA. It is keep giving very ...
4
votes
2answers
442 views

What are the “minimum requirements” for a single cell?

I saw a description of the "minimum requirements" for a cell at http://creation.com/origin-of-life in the section called "What are the minimum requirements for a cell to live?" and I'm wondering if ...
0
votes
1answer
36 views

tandem repeat sequence; causes of contraction and/or expansion question

Question: Which of the following events, occurring within a tandem repeat sequence, will cause an expansion or contraction of the array? A) Endoduplication B) homologous recombination C) ...
0
votes
0answers
53 views

mutations induced by transposons

Question: In contrast to chemically-induced mutations, mutations induced by transposons are more likely to ... be lethal de dominant be stable revert to wild types be a gain of function The ...
2
votes
1answer
63 views

How does Cas9 interact with CRISPR?

I read that Cas9 protein along with guided RNA binds at a specific DNA fragment of foreign organism integrated in a host organism DNA. To make the host immune to virus infection Cas9 along with gRNA ...
1
vote
0answers
34 views

How are CheY, CheA, CheW, CheZ pronounced in speech?

This is a quick followup question to this question about proteins that play important roles in chemotaxis: How does one pronounce the protein names "CheY", "CheW", etc., in English? My guess would ...
0
votes
1answer
40 views

Does the new virus tree of life change their position between living and non-living things?

Viruses still do not fit the criteria of living or it's simplest form (the living cell), why would some say that the new virus tree of life makes it more closer to life? Aren't mitochondria in a point ...
2
votes
1answer
551 views

How to calculate or know by experiment the entropy of enzymes or protein?

How do you calculate or experimentally determine the entropy of enzymes or protein? In particular, I am interested in Boltzmann and conformational entropy, and Gibbs free energy. Any references are ...
1
vote
1answer
40 views

Resolution of gel electrophoresis

My professor mentioned the resolution of the gel in gel electrophoresis. He stated that agarose has large pores and thus low resolution whereas polyacrylamide has the opposite. I don't understand ...
3
votes
3answers
112 views

Abbreviations for molecules: What are CheW, CheA, CheY?

I've encountered the abbreviations such as "CheW" and "CheA" for certain organic molecules. For example: Proteins associating with the Tar complex include the autophosphorylating protein kinase ...
2
votes
1answer
51 views

How can E. coli affect C. elegans expression?

Plasmids can be transferred to E. coli. These transformed E. coli can be fed to C. elegans to silence its gene expression by RNAi. How can E.coli release RNAi to C. elegans? Even if we assume E. ...
3
votes
1answer
1k views

How does blue white screening work in selecting E coli that have taken up a plasmid vector?

The plasmid vector I am referring to is pCR 2.1 - TOPO. I added the vector to the E coli and plated them up onto LB+amp+X-gal plate, then incubated. After incubation the plates had two types of ...
2
votes
0answers
37 views

Why is there a size limit on inserts that a plasmid can accept?

Throughout my undergraduate education I have been taught that plasmids can't carry very large inserts, but I have never been told why. Any insight would be greatly appreciated.
1
vote
0answers
41 views

Protein modification and ATP consumption

According to wikipedia there exists a lot of ways to modify a protein (post-translationally). Just to mention few: phosphorylation, dephosphorylation, glycosylation... While phosphorylation requires ...
4
votes
1answer
48 views

What was Protein G named after?

Protein G (the bacterial antibody binding protein) is often used to pulldown antibodies, for example in chromatin immunoprecipitation (ChIP) experiments. However, I was unable to find a site ...
0
votes
0answers
27 views

How does one predict the methylation pattern?

Suppose, we have a double stranded DNA like 5' AGCTAGGAGAGACCAGGTTCC 3' 3' TCGATCCTCTCTGGTCCAAGG 5' Where would the methylated cytosine be? Is there any randomness?
1
vote
0answers
15 views

E.coli division and its DNA replication [duplicate]

E.coli divides in 20 minutes and its DNA replicates in 38 minutes .Kindly explain.
0
votes
0answers
25 views

Is there a good easy protocol for extracting proteins(enzymes) from fungal mycelium?

I quantify the enzyme (polygalacturanase)activity by DNSA method.To determine endo-polygalacturonase activity I'm searching for a good easy enzyme extracting method.Any suggestions for a suitable ...
0
votes
1answer
56 views

which organelle produce glycogen phosphorylase and why

I know that Glycogen phosphorylase doesn't produce from rough endoplasmic reticulum in liver cell. But almost every proteins such as insulin receptor, serum albumin, and lysosomal enzyme have to ...
1
vote
0answers
51 views

Genetic mapping problem

A prototrophic Hfr strain of E. coli with the genotype trp+ purB- pyrC+ is conjugated with an F- strain with the genotype trp- purB+ pyrC- . The trp gene is known to enter last. The following numbers ...
0
votes
0answers
14 views

Growth of Yeast in Different pH Mediums

Will yeast grow better in acidic, basic or neutral mediums? Why? Will the medium affect the growth of yeast? (Yeast cell membrane is semi-permeable).
2
votes
0answers
186 views

Why does supercoiled DNA run faster?

The DNA exists in linear and cirular forms. The latter form has interesting feature called Supercoiling. The more number of writhe makes it more supercoiled because of which it gets more compact. ...
2
votes
0answers
51 views

Why is A-U bond less stable than A-T bond?

I have encountered the following fact many times, but have not yet encountered a possible explanation for it. Will you please help me understand the molecular mechanism by which the bond between ...
1
vote
3answers
598 views

Do we consume dna, proteins of other organisms?

When we eat raw meat, e.g. chicken or fish, we are actually consuming the DNA, proteins etc. which are present in their cells. Wouldn't this affect our cell functions as this DNA might enter our ...
1
vote
3answers
200 views

Can ampicillin resistant bacteria survive penicillin plate?

in my molecular bio class we were asked a trick question: If the bacteria has a plasmid with that grants it ampicillin ressistance, can the bacteria survive if placed in penicillin? I gave it a ...
3
votes
2answers
135 views

Restriction sites

I would like to know: how many restriction sites does a restriction enzyme use on a DNA molecule? In other words: If a sequence on a plasmid contains the following bases: ATTGCAGTCTG and I want ...
1
vote
1answer
110 views

Why does SDS-PAGE use for protein, and agarose use for nucleic acid?

My question maybe very primary, but after I learned this part, questions always follow me. SDS-PAGE gel works for detect protein, agarose gel works for detect nucleic acid, so here is my question: 1. ...
14
votes
4answers
9k views

Why we have no enzyme to digest cellulose?

As we know, cellulose is the most abundant polysaccharide in nature. Why don't we have any enzyme to digest cellulose?
2
votes
0answers
16 views

Why are multiple copies of the 35S enhancer used for overexpression in plants?

I know that the CaMV 35S promoter is widely used for transgenic plants, and I also know that it can be used as an enhancer element for overexpression. I noticed that it is always used as a ...
0
votes
1answer
53 views

Molecular weight of my 2-D gel

I am a little confuse when I try to figure out the molecular weight of the marker on my gel. I used NuPage Novex 4-12% bis-tris gel and Mark12™ Unstained Standard as a marker. Could please someone ...
0
votes
2answers
47 views

If a given DNA oligo is an aptamer, will the corresponding RNA oligo with the same sequence be an aptamer aswell?

Functionality of aptamers depends upon the oligo's sequence and secondary structure. So, if I take a DNA aptamer and make an RNA oligo of the same sequence (T replaced with U obviously), will this RNA ...
5
votes
2answers
463 views

Evolution of endosymbionts?

Mitochondria and plastids in eukaryotes evolved through a process of endosymbiosis. How does an event like a eukaryote engulfing a bacteria, become a part of the genome? Some of these primitive ...
1
vote
1answer
27 views

In vitro virus assembly

Are researchers able to assemble viruses in vitro? For example, I imagine that a phage display library may be generated by throwing in a test tube the capsid proteins (or what have you) along with ...
0
votes
0answers
13 views

Using Q solution with ready made MasterMix

I am exploring the possibility of using Q solution (5x) to get rid of non specific bands in PCR. I mostly use a MasterMix and not separate aliquots of dNTPs, Taq, buffer etc. In principle, adding Q ...
1
vote
1answer
57 views

How to interpret the simple sequence repeat (SSR) on the coding sequence, but not the related protein sequence?

I have predicted some SSR repeat on the gene of interest using SSRLocator program, which the result creates a question for me. Please consider the below sequence, which is part of gene sequence of ...
0
votes
0answers
43 views

How does intron retention make the alternative transcript non-coding?

I faced with a non-coding transcript that specified as one the isoform of BIN1. It sounds that this isoform generated as a result of alternative splicing with a intron retained; am I right? However, ...
1
vote
1answer
126 views

How do DNA-binding proteins determine that they're binding to the correct DNA base pairs?

My professor posed this question to the class today - "How do DNA binding proteins specifically bind to base pairs?" He alluded to the different arrangements of hydrogen-bond donor and acceptors in ...