The study of the molecular processes of the nucleus and cell function.

learn more… | top users | synonyms

2
votes
2answers
257 views

Why is beta actin commonly used as a control in Western blots?

It is about the western blot question. The paper:http://www.sciencedirect.com/science/article/pii/S1931312813001145. In the western blot experiment in this paper, they use beta actin as control. And ...
5
votes
2answers
129 views

Non-ribosomal peptide synthesis: why Glutathione cannot be produced by the ribosome?

Case: I am writing a summary for a class in protein structure and function, and was asked to describe some different ways that peptides are synthesized (that does not involve the ribosome). I ...
1
vote
1answer
172 views

What is the reason for having an extra recognition site for a restriction enzyme?

Can the size of a supercoiled plasmid DNA be determined by using standard DNA size fragment electrophoresed in parallel? 2. An unknown DNA molecule was cleaved using several restriction enzymes ...
1
vote
0answers
22 views

If two different diseases have more than one common pathway, the relationship between their occurences?

I just wonder that are there any special relationship between the pathway and disease occurrence. For example, there are cancer A and cancer B (and they have more than one common pathway). Then if ...
4
votes
1answer
51 views

Function of NaCl in yeast shuttle prep of plasmids

What is the role of NaCl in plasmid isolation from yeast cells using plasmid rescue solution? If the basic theory behind the method is alkaline lysis, then we is NaCl used and not NaOH?
2
votes
1answer
93 views

How does one insert cas9 into animal cells?

How could cas9 be inserted into cells by researchers looking to edit a genome? I imagine for engineering bacterial systems you could just put in the cas9 coding region in an expression vector, but is ...
3
votes
1answer
57 views

How to predict a mRNA secondary structure with a large sequence?

When I use some web servers to predict a mRNA secondary structure, I find they always required in a small size sequence. If I use a long sequence and cut it into small parts, do these small parts ...
0
votes
1answer
58 views

On which amino-acids residue is the SDS acting on?

I would like to know exactly what is the mechanisme of the SDS, and I would like to know on which amino-acids residue the SDS is acting on. Can you help me please ? Thank you in advance !
2
votes
1answer
51 views

Difference between the P4 and P5 subtypes of P-type ATPases in plants

In plants there are various kinds of P-type ATPases. What is difference between P4-ATPase and P5-ATPase?
1
vote
1answer
50 views

What is the attacking mechanism of RF on IgG?

Rheumatoid Factor (RF) attacks Fc portion of Immunoglobulin G (IgG), I want to know the underlying mechanism at molecular level. Also, what type of bond or attachment is made by RF and Fc portion of ...
1
vote
0answers
26 views

How do molecular recognition features work?

The occurrence of relatively short (10–70 residues), loosely structured protein regions bind within longer, largely disordered sequences that were characterized as bound to larger proteins. These ...
1
vote
1answer
34 views

Producing a genetically modified animal with cell walls [closed]

I'm curious if there has been any genetic experiments transferring cell wall producing genes into the genome of a animal model organism such as the fruit fly (Drosophila melanogaster) or a larger ...
1
vote
0answers
36 views

Is there a better lysis buffer than this for fungal DNA extraction?

I've being using this lysis buffer for fungal DNA extraction,lysis buffer - 400mM TRis-HCl(pH8.0), 60mM EDTA(pH8.0), 150mM NaCl, 1% SDS and containing 40microgram/ml RnaseA. It is keep giving very ...
1
vote
0answers
43 views

How are CheY, CheA, CheW, CheZ pronounced in speech?

This is a quick followup question to this question about proteins that play important roles in chemotaxis: How does one pronounce the protein names "CheY", "CheW", etc., in English? My guess would ...
1
vote
0answers
91 views

mutations induced by transposons

Question: In contrast to chemically-induced mutations, mutations induced by transposons are more likely to ... be lethal de dominant be stable revert to wild types be a gain of function The ...
1
vote
1answer
53 views

tandem repeat sequence; causes of contraction and/or expansion question

Question: Which of the following events, occurring within a tandem repeat sequence, will cause an expansion or contraction of the array? A) Endoduplication B) homologous recombination C) ...
1
vote
1answer
45 views

Does the new virus tree of life change their position between living and non-living things?

Viruses still do not fit the criteria of living or it's simplest form (the living cell), why would some say that the new virus tree of life makes it more closer to life? Aren't mitochondria in a point ...
1
vote
1answer
42 views

Resolution of gel electrophoresis

My professor mentioned the resolution of the gel in gel electrophoresis. He stated that agarose has large pores and thus low resolution whereas polyacrylamide has the opposite. I don't understand ...
3
votes
3answers
127 views

Abbreviations for molecules: What are CheW, CheA, CheY?

I've encountered the abbreviations such as "CheW" and "CheA" for certain organic molecules. For example: Proteins associating with the Tar complex include the autophosphorylating protein kinase ...
2
votes
0answers
45 views

Why is there a size limit on inserts that a plasmid can accept?

Throughout my undergraduate education I have been taught that plasmids can't carry very large inserts, but I have never been told why. Any insight would be greatly appreciated.
2
votes
1answer
64 views

How can E. coli affect C. elegans expression?

Plasmids can be transferred to E. coli. These transformed E. coli can be fed to C. elegans to silence its gene expression by RNAi. How can E.coli release RNAi to C. elegans? Even if we assume E. ...
1
vote
1answer
73 views

Genomic DNA isolation from wheat

Can I use dry seed, wheat for example, in place of young leaves for isolation and purification of genomic DNA for PCR amplification? The goal of my experiment is to validate a novel gene which is ...
1
vote
0answers
31 views

How does one predict the methylation pattern?

Suppose, we have a double stranded DNA like 5' AGCTAGGAGAGACCAGGTTCC 3' 3' TCGATCCTCTCTGGTCCAAGG 5' Where would the methylated cytosine be? Is there any randomness?
1
vote
0answers
47 views

Protein modification and ATP consumption

According to wikipedia there exists a lot of ways to modify a protein (post-translationally). Just to mention few: phosphorylation, dephosphorylation, glycosylation... While phosphorylation requires ...
1
vote
0answers
15 views

E.coli division and its DNA replication [duplicate]

E.coli divides in 20 minutes and its DNA replicates in 38 minutes .Kindly explain.
4
votes
1answer
53 views

What was Protein G named after?

Protein G (the bacterial antibody binding protein) is often used to pulldown antibodies, for example in chromatin immunoprecipitation (ChIP) experiments. However, I was unable to find a site ...
1
vote
0answers
32 views

Is there a good easy protocol for extracting proteins(enzymes) from fungal mycelium?

I quantify the enzyme (polygalacturanase)activity by DNSA method.To determine endo-polygalacturonase activity I'm searching for a good easy enzyme extracting method.Any suggestions for a suitable ...
0
votes
1answer
69 views

which organelle produce glycogen phosphorylase and why

I know that Glycogen phosphorylase doesn't produce from rough endoplasmic reticulum in liver cell. But almost every proteins such as insulin receptor, serum albumin, and lysosomal enzyme have to ...
1
vote
0answers
16 views

Growth of Yeast in Different pH Mediums

Will yeast grow better in acidic, basic or neutral mediums? Why? Will the medium affect the growth of yeast? (Yeast cell membrane is semi-permeable).
1
vote
0answers
60 views

Genetic mapping problem

A prototrophic Hfr strain of E. coli with the genotype trp+ purB- pyrC+ is conjugated with an F- strain with the genotype trp- purB+ pyrC- . The trp gene is known to enter last. The following numbers ...
4
votes
1answer
80 views

Why is an A-U bond less stable than an A-T bond?

I have encountered the following fact many times, but have not yet encountered a possible explanation for it. Will you please help me understand the molecular mechanism by which the bond between ...
2
votes
0answers
445 views

Why does supercoiled DNA run faster?

The DNA exists in linear and cirular forms. The latter form has interesting feature called Supercoiling. The more number of writhe makes it more supercoiled because of which it gets more compact. ...
1
vote
1answer
175 views

Why does SDS-PAGE use for protein, and agarose use for nucleic acid?

My question maybe very primary, but after I learned this part, questions always follow me. SDS-PAGE gel works for detect protein, agarose gel works for detect nucleic acid, so here is my question: 1. ...
1
vote
3answers
375 views

Can ampicillin resistant bacteria survive penicillin plate?

in my molecular bio class we were asked a trick question: If the bacteria has a plasmid with that grants it ampicillin ressistance, can the bacteria survive if placed in penicillin? I gave it a ...
2
votes
0answers
17 views

Why are multiple copies of the 35S enhancer used for overexpression in plants?

I know that the CaMV 35S promoter is widely used for transgenic plants, and I also know that it can be used as an enhancer element for overexpression. I noticed that it is always used as a ...
2
votes
1answer
410 views

How to find the concentration of an enzyme?

I need to know the concentration of pectinase enzyme (sigma aldrich) which has stated 5KU, 5U/mg protein (lowry) and lot result 20U/mg protein in the label of the enzyme bottle. This is all it has ...
1
vote
1answer
29 views

Refer to Ran-GEF as a coenzyme?

Ran-GEF facilitates an exchange of GDP for GTP in the formation of Ran-GTP in the nucleus as part of gated import of proteins. Would I be correct in calling Ran-GEF or Ran-GAP coenzymes?
0
votes
1answer
54 views

Molecular weight of my 2-D gel

I am a little confuse when I try to figure out the molecular weight of the marker on my gel. I used NuPage Novex 4-12% bis-tris gel and Mark12™ Unstained Standard as a marker. Could please someone ...
1
vote
1answer
53 views

Do snRNAs exit the nucleus or not?

In Molecular Biology of The Cell (Alberts, et al., 2015), it lists the various RNAs that are trafficked through the Nuclear Pore Complex (NPC) into the cytoplasm. The list includes snRNAs, but I ...
5
votes
2answers
479 views

Evolution of endosymbionts?

Mitochondria and plastids in eukaryotes evolved through a process of endosymbiosis. How does an event like a eukaryote engulfing a bacteria, become a part of the genome? Some of these primitive ...
2
votes
3answers
798 views

Do we consume dna, proteins of other organisms?

When we eat raw meat, e.g. chicken or fish, we are actually consuming the DNA, proteins etc. which are present in their cells. Wouldn't this affect our cell functions as this DNA might enter our ...
1
vote
1answer
28 views

In vitro virus assembly

Are researchers able to assemble viruses in vitro? For example, I imagine that a phage display library may be generated by throwing in a test tube the capsid proteins (or what have you) along with ...
1
vote
0answers
18 views

Using Q solution with ready made MasterMix

I am exploring the possibility of using Q solution (5x) to get rid of non specific bands in PCR. I mostly use a MasterMix and not separate aliquots of dNTPs, Taq, buffer etc. In principle, adding Q ...
2
votes
1answer
78 views

How does Cas9 interact with CRISPR?

I read that Cas9 protein along with guided RNA binds at a specific DNA fragment of foreign organism integrated in a host organism DNA. To make the host immune to virus infection Cas9 along with gRNA ...
1
vote
1answer
66 views

How to interpret the simple sequence repeat (SSR) on the coding sequence, but not the related protein sequence?

I have predicted some SSR repeat on the gene of interest using SSRLocator program, which the result creates a question for me. Please consider the below sequence, which is part of gene sequence of ...
1
vote
0answers
47 views

How does intron retention make the alternative transcript non-coding?

I faced with a non-coding transcript that specified as one the isoform of BIN1. It sounds that this isoform generated as a result of alternative splicing with a intron retained; am I right? However, ...
4
votes
1answer
146 views

How does NHEJ cause indels?

I was reading up on CRISPR-cas9 and how it works and I am having trouble wrapping my head around how NHEJ to repair the DSB can cause indels to occur. Shouldn't the NHEJ just stick the two strands of ...
1
vote
1answer
218 views

How do DNA-binding proteins determine that they're binding to the correct DNA base pairs?

My professor posed this question to the class today - "How do DNA binding proteins specifically bind to base pairs?" He alluded to the different arrangements of hydrogen-bond donor and acceptors in ...
1
vote
2answers
693 views

Are eukaroytic promoters located in the 5' UTR region?

I was wondering if promoter sequences are located on 5'UTR region in eukaryotic organisms?
0
votes
1answer
51 views

Was site-directed mutagenesis used to study the effects of sickle-cell anemia?

The title says it all. I am inquiring whether or not site-directed mutagenesis was used to study the effects of sickle-cell anemia/figuring out that specific amino acid mutation was the problem.