The study of the molecular processes of the nucleus and cell function.

learn more… | top users | synonyms

5
votes
1answer
130 views

How is adrenaline a ligand?

I keep reading that adrenaline is a ligand, however from what I understand a ligand is a molecule or ion which donates a pair of electrons to a central transition metal ion in a complex. How then is ...
1
vote
1answer
74 views

Is there any way to make protein pass through cell membrane?

Protein cannot pass cell membrane because it's a large molecule. Until now, is there any technique that can make protein pass through the cell membrane in vivo? I want to create a protein-drug that ...
1
vote
2answers
84 views

Getting PCR amplification at annealing higher than Tm!

I am amplifying a gene where in a gradient pcr i am getting amplification at an annealing temperature about 5 degrees (67) higher than Tm (62.5)? What is wrong here? Also, I am getting a very strong ...
0
votes
2answers
43 views

General transcription factors vs. DNA Binding transcription factors

I know that DNA binding transcription factors are trans-acting, but what about general transcription factors? Are they cis or trans acting?
0
votes
0answers
36 views

What is the difference between basal transcription and activated transcription?

My professor keeps mentioning these two forms of transcription and I'm completely confused as to what the difference is between them. I didn't even realise there were two different types of ...
1
vote
1answer
47 views

Can we create custom gene/protein?

Does it possible to create any custom gene or protein we want with current technology? I have a protein sequence or a gene sequence about 4000 bp write down on my computer, is there anyway to "print" ...
1
vote
0answers
23 views

What is the difference between cell, membrane and animal based assay?

I am reading a review about MRP1, discussing it's ability to extrude different compounds from cell interior. When describing the different experiments conducted to observe the MRP1's reaction to ...
3
votes
1answer
128 views

In CRISPR bacteria, how does viral genomes get integrated into the spacers of CRISPR? Also, in its use, where does Cas9 cut the DNA?

I've been out of Biology for about a year polishing my programming skills. I know CRISPR/Cas9 allows targeted 'cutting' of DNA via RNA-guidance. Few questions regarding this. Regarding to its ...
0
votes
2answers
186 views

Electroporation vs gene guns [closed]

What are the pros and cons of using electroporators (left) and gene guns (right) for transformation in terms of: Price Target organism Efficacy Ease of use Maintenance
1
vote
0answers
33 views

Is pathlength correction vital to be included while quantifying protein

I am trying to quantify protein in serum/plasma samples. I have carried out biuret assay for my samples using microplate reader. While performing I encountered the doubt whether I should include ...
2
votes
0answers
40 views

Gene sequence and DNA [closed]

can anyone help me with this? It shows two gene sequences for a sheep and a goat. ...
2
votes
1answer
106 views

What is the molecular mechanism of odorant transduction signaling pathway?

I have read a few papers on the topic of odorant signaling pathway. The following papers are listed as examples. However, I found that there is not a clear pathway representation of the odorant ...
1
vote
0answers
34 views

Wash adsorbed protein without destroying Biotin-Avidin-Mechanism

I am looking for reliable protocols to wash protein (e.g. Fibronectin) adsorbed onto glass surfaces. According to Protein immobilization literature, people usually use 1% SDS and some incubation time. ...
3
votes
1answer
85 views

What is the shortest mRNA the ribosome can read to produce a peptide?

This question came as a comment on a previous question regarding non-ribosomal peptide synthesis, and why Glutathione cannot be synthesized by the ribosome. In general, Glutathione has a "gamma" ...
1
vote
1answer
33 views

Conjugated deoxyribonucleotides

I'm currently learning about using PCR techniques to make fluorescently labelled DNA probes, and the textbook mentions "conjugated deoxyribonucleotides" Can someone explain what these are? Nothing ...
2
votes
2answers
392 views

Why is beta actin commonly used as a control in Western blots?

It is about the western blot question. The paper:http://www.sciencedirect.com/science/article/pii/S1931312813001145. In the western blot experiment in this paper, they use beta actin as control. And ...
5
votes
2answers
137 views

Non-ribosomal peptide synthesis: why Glutathione cannot be produced by the ribosome?

Case: I am writing a summary for a class in protein structure and function, and was asked to describe some different ways that peptides are synthesized (that does not involve the ribosome). I ...
1
vote
1answer
179 views

What is the reason for having an extra recognition site for a restriction enzyme?

Can the size of a supercoiled plasmid DNA be determined by using standard DNA size fragment electrophoresed in parallel? 2. An unknown DNA molecule was cleaved using several restriction enzymes ...
1
vote
0answers
23 views

If two different diseases have more than one common pathway, the relationship between their occurences?

I just wonder that are there any special relationship between the pathway and disease occurrence. For example, there are cancer A and cancer B (and they have more than one common pathway). Then if ...
4
votes
1answer
52 views

Function of NaCl in yeast shuttle prep of plasmids

What is the role of NaCl in plasmid isolation from yeast cells using plasmid rescue solution? If the basic theory behind the method is alkaline lysis, then we is NaCl used and not NaOH?
2
votes
1answer
106 views

How does one insert cas9 into animal cells?

How could cas9 be inserted into cells by researchers looking to edit a genome? I imagine for engineering bacterial systems you could just put in the cas9 coding region in an expression vector, but is ...
3
votes
1answer
57 views

How to predict a mRNA secondary structure with a large sequence?

When I use some web servers to predict a mRNA secondary structure, I find they always required in a small size sequence. If I use a long sequence and cut it into small parts, do these small parts ...
0
votes
1answer
63 views

On which amino-acids residue is the SDS acting on?

I would like to know exactly what is the mechanisme of the SDS, and I would like to know on which amino-acids residue the SDS is acting on. Can you help me please ? Thank you in advance !
2
votes
1answer
54 views

Difference between the P4 and P5 subtypes of P-type ATPases in plants

In plants there are various kinds of P-type ATPases. What is difference between P4-ATPase and P5-ATPase?
1
vote
1answer
53 views

What is the attacking mechanism of RF on IgG?

Rheumatoid Factor (RF) attacks Fc portion of Immunoglobulin G (IgG), I want to know the underlying mechanism at molecular level. Also, what type of bond or attachment is made by RF and Fc portion of ...
1
vote
0answers
26 views

How do molecular recognition features work?

The occurrence of relatively short (10–70 residues), loosely structured protein regions bind within longer, largely disordered sequences that were characterized as bound to larger proteins. These ...
1
vote
1answer
34 views

Producing a genetically modified animal with cell walls [closed]

I'm curious if there has been any genetic experiments transferring cell wall producing genes into the genome of a animal model organism such as the fruit fly (Drosophila melanogaster) or a larger ...
1
vote
0answers
37 views

Is there a better lysis buffer than this for fungal DNA extraction?

I've being using this lysis buffer for fungal DNA extraction,lysis buffer - 400mM TRis-HCl(pH8.0), 60mM EDTA(pH8.0), 150mM NaCl, 1% SDS and containing 40microgram/ml RnaseA. It is keep giving very ...
1
vote
0answers
45 views

How are CheY, CheA, CheW, CheZ pronounced in speech?

This is a quick followup question to this question about proteins that play important roles in chemotaxis: How does one pronounce the protein names "CheY", "CheW", etc., in English? My guess would ...
1
vote
0answers
106 views

mutations induced by transposons

Question: In contrast to chemically-induced mutations, mutations induced by transposons are more likely to ... be lethal de dominant be stable revert to wild types be a gain of function The ...
1
vote
1answer
56 views

tandem repeat sequence; causes of contraction and/or expansion question

Question: Which of the following events, occurring within a tandem repeat sequence, will cause an expansion or contraction of the array? A) Endoduplication B) homologous recombination C) ...
1
vote
1answer
46 views

Does the new virus tree of life change their position between living and non-living things?

Viruses still do not fit the criteria of living or it's simplest form (the living cell), why would some say that the new virus tree of life makes it more closer to life? Aren't mitochondria in a point ...
1
vote
1answer
44 views

Resolution of gel electrophoresis

My professor mentioned the resolution of the gel in gel electrophoresis. He stated that agarose has large pores and thus low resolution whereas polyacrylamide has the opposite. I don't understand ...
3
votes
3answers
130 views

Abbreviations for molecules: What are CheW, CheA, CheY?

I've encountered the abbreviations such as "CheW" and "CheA" for certain organic molecules. For example: Proteins associating with the Tar complex include the autophosphorylating protein kinase ...
2
votes
0answers
49 views

Why is there a size limit on inserts that a plasmid can accept?

Throughout my undergraduate education I have been taught that plasmids can't carry very large inserts, but I have never been told why. Any insight would be greatly appreciated.
2
votes
1answer
68 views

How can E. coli affect C. elegans expression?

Plasmids can be transferred to E. coli. These transformed E. coli can be fed to C. elegans to silence its gene expression by RNAi. How can E.coli release RNAi to C. elegans? Even if we assume E. ...
2
votes
1answer
76 views

Genomic DNA isolation from wheat

Can I use dry seed, wheat for example, in place of young leaves for isolation and purification of genomic DNA for PCR amplification? The goal of my experiment is to validate a novel gene which is ...
1
vote
0answers
31 views

How does one predict the methylation pattern?

Suppose, we have a double stranded DNA like 5' AGCTAGGAGAGACCAGGTTCC 3' 3' TCGATCCTCTCTGGTCCAAGG 5' Where would the methylated cytosine be? Is there any randomness?
1
vote
0answers
47 views

Protein modification and ATP consumption

According to wikipedia there exists a lot of ways to modify a protein (post-translationally). Just to mention few: phosphorylation, dephosphorylation, glycosylation... While phosphorylation requires ...
1
vote
0answers
15 views

E.coli division and its DNA replication [duplicate]

E.coli divides in 20 minutes and its DNA replicates in 38 minutes .Kindly explain.
4
votes
1answer
54 views

What was Protein G named after?

Protein G (the bacterial antibody binding protein) is often used to pulldown antibodies, for example in chromatin immunoprecipitation (ChIP) experiments. However, I was unable to find a site ...
1
vote
0answers
32 views

Is there a good easy protocol for extracting proteins(enzymes) from fungal mycelium?

I quantify the enzyme (polygalacturanase)activity by DNSA method.To determine endo-polygalacturonase activity I'm searching for a good easy enzyme extracting method.Any suggestions for a suitable ...
0
votes
1answer
70 views

which organelle produce glycogen phosphorylase and why

I know that Glycogen phosphorylase doesn't produce from rough endoplasmic reticulum in liver cell. But almost every proteins such as insulin receptor, serum albumin, and lysosomal enzyme have to ...
1
vote
0answers
17 views

Growth of Yeast in Different pH Mediums

Will yeast grow better in acidic, basic or neutral mediums? Why? Will the medium affect the growth of yeast? (Yeast cell membrane is semi-permeable).
1
vote
0answers
62 views

Genetic mapping problem

A prototrophic Hfr strain of E. coli with the genotype trp+ purB- pyrC+ is conjugated with an F- strain with the genotype trp- purB+ pyrC- . The trp gene is known to enter last. The following numbers ...
4
votes
1answer
81 views

Why is an A-U bond less stable than an A-T bond?

I have encountered the following fact many times, but have not yet encountered a possible explanation for it. Will you please help me understand the molecular mechanism by which the bond between ...
2
votes
0answers
478 views

Why does supercoiled DNA run faster?

The DNA exists in linear and cirular forms. The latter form has interesting feature called Supercoiling. The more number of writhe makes it more supercoiled because of which it gets more compact. ...
1
vote
1answer
205 views

Why does SDS-PAGE use for protein, and agarose use for nucleic acid?

My question maybe very primary, but after I learned this part, questions always follow me. SDS-PAGE gel works for detect protein, agarose gel works for detect nucleic acid, so here is my question: 1. ...
1
vote
3answers
396 views

Can ampicillin resistant bacteria survive penicillin plate?

in my molecular bio class we were asked a trick question: If the bacteria has a plasmid with that grants it ampicillin ressistance, can the bacteria survive if placed in penicillin? I gave it a ...
2
votes
0answers
18 views

Why are multiple copies of the 35S enhancer used for overexpression in plants?

I know that the CaMV 35S promoter is widely used for transgenic plants, and I also know that it can be used as an enhancer element for overexpression. I noticed that it is always used as a ...