The study of the molecular processes of the nucleus and cell function.

learn more… | top users | synonyms

2
votes
1answer
86 views

How does Cas9 interact with CRISPR?

I read that Cas9 protein along with guided RNA binds at a specific DNA fragment of foreign organism integrated in a host organism DNA. To make the host immune to virus infection Cas9 along with gRNA ...
1
vote
0answers
47 views

How are CheY, CheA, CheW, CheZ pronounced in speech?

This is a quick followup question to this question about proteins that play important roles in chemotaxis: How does one pronounce the protein names "CheY", "CheW", etc., in English? My guess would ...
1
vote
1answer
46 views

Does the new virus tree of life change their position between living and non-living things?

Viruses still do not fit the criteria of living or it's simplest form (the living cell), why would some say that the new virus tree of life makes it more closer to life? Aren't mitochondria in a point ...
2
votes
1answer
634 views

How to calculate or know by experiment the entropy of enzymes or protein?

How do you calculate or experimentally determine the entropy of enzymes or protein? In particular, I am interested in Boltzmann and conformational entropy, and Gibbs free energy. Any references are ...
1
vote
1answer
46 views

Resolution of gel electrophoresis

My professor mentioned the resolution of the gel in gel electrophoresis. He stated that agarose has large pores and thus low resolution whereas polyacrylamide has the opposite. I don't understand ...
3
votes
3answers
133 views

Abbreviations for molecules: What are CheW, CheA, CheY?

I've encountered the abbreviations such as "CheW" and "CheA" for certain organic molecules. For example: Proteins associating with the Tar complex include the autophosphorylating protein kinase ...
2
votes
1answer
69 views

How can E. coli affect C. elegans expression?

Plasmids can be transferred to E. coli. These transformed E. coli can be fed to C. elegans to silence its gene expression by RNAi. How can E.coli release RNAi to C. elegans? Even if we assume E. ...
3
votes
1answer
2k views

How does blue white screening work in selecting E coli that have taken up a plasmid vector?

The plasmid vector I am referring to is pCR 2.1 - TOPO. I added the vector to the E coli and plated them up onto LB+amp+X-gal plate, then incubated. After incubation the plates had two types of ...
2
votes
0answers
52 views

Why is there a size limit on inserts that a plasmid can accept?

Throughout my undergraduate education I have been taught that plasmids can't carry very large inserts, but I have never been told why. Any insight would be greatly appreciated.
1
vote
0answers
47 views

Protein modification and ATP consumption

According to wikipedia there exists a lot of ways to modify a protein (post-translationally). Just to mention few: phosphorylation, dephosphorylation, glycosylation... While phosphorylation requires ...
4
votes
1answer
55 views

What was Protein G named after?

Protein G (the bacterial antibody binding protein) is often used to pulldown antibodies, for example in chromatin immunoprecipitation (ChIP) experiments. However, I was unable to find a site ...
1
vote
0answers
33 views

How does one predict the methylation pattern?

Suppose, we have a double stranded DNA like 5' AGCTAGGAGAGACCAGGTTCC 3' 3' TCGATCCTCTCTGGTCCAAGG 5' Where would the methylated cytosine be? Is there any randomness?
1
vote
0answers
15 views

E.coli division and its DNA replication [duplicate]

E.coli divides in 20 minutes and its DNA replicates in 38 minutes .Kindly explain.
1
vote
0answers
33 views

Is there a good easy protocol for extracting proteins(enzymes) from fungal mycelium?

I quantify the enzyme (polygalacturanase)activity by DNSA method.To determine endo-polygalacturonase activity I'm searching for a good easy enzyme extracting method.Any suggestions for a suitable ...
0
votes
1answer
73 views

which organelle produce glycogen phosphorylase and why

I know that Glycogen phosphorylase doesn't produce from rough endoplasmic reticulum in liver cell. But almost every proteins such as insulin receptor, serum albumin, and lysosomal enzyme have to ...
1
vote
0answers
64 views

Genetic mapping problem

A prototrophic Hfr strain of E. coli with the genotype trp+ purB- pyrC+ is conjugated with an F- strain with the genotype trp- purB+ pyrC- . The trp gene is known to enter last. The following numbers ...
1
vote
0answers
17 views

Growth of Yeast in Different pH Mediums

Will yeast grow better in acidic, basic or neutral mediums? Why? Will the medium affect the growth of yeast? (Yeast cell membrane is semi-permeable).
2
votes
0answers
512 views

Why does supercoiled DNA run faster?

The DNA exists in linear and cirular forms. The latter form has interesting feature called Supercoiling. The more number of writhe makes it more supercoiled because of which it gets more compact. ...
2
votes
3answers
911 views

Do we consume dna, proteins of other organisms?

When we eat raw meat, e.g. chicken or fish, we are actually consuming the DNA, proteins etc. which are present in their cells. Wouldn't this affect our cell functions as this DNA might enter our ...
1
vote
3answers
417 views

Can ampicillin resistant bacteria survive penicillin plate?

in my molecular bio class we were asked a trick question: If the bacteria has a plasmid with that grants it ampicillin ressistance, can the bacteria survive if placed in penicillin? I gave it a ...
3
votes
2answers
153 views

Restriction sites

I would like to know: how many restriction sites does a restriction enzyme use on a DNA molecule? In other words: If a sequence on a plasmid contains the following bases: ATTGCAGTCTG and I want ...
1
vote
1answer
222 views

Why does SDS-PAGE use for protein, and agarose use for nucleic acid?

My question maybe very primary, but after I learned this part, questions always follow me. SDS-PAGE gel works for detect protein, agarose gel works for detect nucleic acid, so here is my question: 1. ...
14
votes
4answers
11k views

Why we have no enzyme to digest cellulose?

As we know, cellulose is the most abundant polysaccharide in nature. Why don't we have any enzyme to digest cellulose?
2
votes
0answers
20 views

Why are multiple copies of the 35S enhancer used for overexpression in plants?

I know that the CaMV 35S promoter is widely used for transgenic plants, and I also know that it can be used as an enhancer element for overexpression. I noticed that it is always used as a ...
0
votes
1answer
54 views

Molecular weight of my 2-D gel

I am a little confuse when I try to figure out the molecular weight of the marker on my gel. I used NuPage Novex 4-12% bis-tris gel and Mark12™ Unstained Standard as a marker. Could please someone ...
1
vote
2answers
69 views

If a given DNA oligo is an aptamer, will the corresponding RNA oligo with the same sequence be an aptamer aswell?

Functionality of aptamers depends upon the oligo's sequence and secondary structure. So, if I take a DNA aptamer and make an RNA oligo of the same sequence (T replaced with U obviously), will this RNA ...
5
votes
2answers
483 views

Evolution of endosymbionts?

Mitochondria and plastids in eukaryotes evolved through a process of endosymbiosis. How does an event like a eukaryote engulfing a bacteria, become a part of the genome? Some of these primitive ...
1
vote
1answer
29 views

In vitro virus assembly

Are researchers able to assemble viruses in vitro? For example, I imagine that a phage display library may be generated by throwing in a test tube the capsid proteins (or what have you) along with ...
1
vote
0answers
18 views

Using Q solution with ready made MasterMix

I am exploring the possibility of using Q solution (5x) to get rid of non specific bands in PCR. I mostly use a MasterMix and not separate aliquots of dNTPs, Taq, buffer etc. In principle, adding Q ...
1
vote
1answer
71 views

How to interpret the simple sequence repeat (SSR) on the coding sequence, but not the related protein sequence?

I have predicted some SSR repeat on the gene of interest using SSRLocator program, which the result creates a question for me. Please consider the below sequence, which is part of gene sequence of ...
1
vote
0answers
48 views

How does intron retention make the alternative transcript non-coding?

I faced with a non-coding transcript that specified as one the isoform of BIN1. It sounds that this isoform generated as a result of alternative splicing with a intron retained; am I right? However, ...
1
vote
1answer
269 views

How do DNA-binding proteins determine that they're binding to the correct DNA base pairs?

My professor posed this question to the class today - "How do DNA binding proteins specifically bind to base pairs?" He alluded to the different arrangements of hydrogen-bond donor and acceptors in A-...
4
votes
1answer
179 views

How does NHEJ cause indels?

I was reading up on CRISPR-cas9 and how it works and I am having trouble wrapping my head around how NHEJ to repair the DSB can cause indels to occur. Shouldn't the NHEJ just stick the two strands of ...
1
vote
2answers
900 views

Are eukaroytic promoters located in the 5' UTR region?

I was wondering if promoter sequences are located on 5'UTR region in eukaryotic organisms?
3
votes
2answers
134 views

Do transposons usually jump from one chromosome to another?

If it is usual occurrence, does it mean that my one gene can change its location from one chromosome to another?
0
votes
1answer
51 views

Was site-directed mutagenesis used to study the effects of sickle-cell anemia?

The title says it all. I am inquiring whether or not site-directed mutagenesis was used to study the effects of sickle-cell anemia/figuring out that specific amino acid mutation was the problem.
2
votes
1answer
245 views

What is a mechanical cue?

I was attending a talk related to neurogenesis. So one professor was asking a question related to biochemical cues and mechanical cues (related to signaling pathways I believe). Cue as far as I ...
1
vote
1answer
154 views

How will changing the concentration of a Tris buffer affect amylase enzyme activity?

For instance if you increase the amount of Tris but pH still does not change then will the enzyme activity still proceed normally? If it does change the pH will it change enzyme structure and why?
1
vote
2answers
51 views

Question about flux and changes in net flux of molecules across a membrane

I've been reading a book called Principles of Human Physiology by Stanfield 5th edition, and was reading a chapter on membrane transport when I came across a figure question which will be posted below....
1
vote
1answer
152 views

Why do the deoxyribonucleotides use T and ribonucleotides use U? [duplicate]

We all know deoxyribonucleotides form DNA while ribonucleotides form RNA, DNA is double stranded while RNA is single stranded, and RNA can transcribe from DNA. We also know that DNA use A, G, C, T, ...
1
vote
0answers
37 views

Why I obtain larger bands than expected after minipreparation?

guys! I made a "home made" minipreparation to obtain my plasmid+insert (totalizing approximately 6Kb). But, when I run a agarose gel, I saw a unique band with 10Kb. Why?
2
votes
1answer
119 views

Are all dipeptides synthesizable?

Probably a basic question, but are all possible dipeptides synthesizable? For 20 amino acids, there should be in principle 190 dipeptides; do they all exist or is there chemistry that makes some ...
2
votes
0answers
70 views

PAGE gel in EtBr

I have been using TBE-PAGE gel to see small fragments of DNA by post-staining that means gel is stained with EtBr after electrophoresis. Someone told me that you can add EtBr before polymerizing ...
1
vote
1answer
32 views

connect three coding sequences with IRES

To express two proteins at once in mammalian cells, expression vectors carrying an IRES (internal ribosomal entry site) are available. Does anyone know any attempt to express three proteins using two ...
1
vote
1answer
67 views

Is T7 promotor leaky in DH5 alpha?

In my experiment I found that a GFP gene under T7 promotor in high copy number pTAC-2 vector is showing green fluorescence producing colonies of DH5 alpha under UV light. what could be the possible ...
1
vote
1answer
47 views

Is galvinoxyl antioxidant assay possible using NMR spectroscopy?

I would like to perform an antioxidant assay using the galvinoxyl protocol. The protocol states that we need EPR spectroscopy, but only NMR spectroscopy is available at my institution. Is there an ...
4
votes
1answer
129 views

How small does a nanobot have to be to “swim through the brain” and access any neuron it wants to?

I read on this question What is in the space between neurons in a brain? that there is actually not much empty space in a brain. But my question is slightly different. Is there a visual demonstration ...
2
votes
0answers
26 views

Can mutation rate be increased for instance by mutagenesis targeting the DNA polymerase?

I am studying a non-cultivable bacterium living in an insect host, and I would like to generate some random mutants of this bacteria while preserving the insect. I am wondering if one way to do so ...
1
vote
0answers
128 views

How can we determine the polarity of fat molecules?

I'm trying to solve a question in a biochemistry quiz, which is asking for classifying a set of lipidic derivatives, by increasing polarity. Unfortunately, we didn't cover the classification of ...
3
votes
0answers
293 views

How much salt [NaCl] is too much in DNA precipitation?

In DNA extractions, how much is too much salt in a CTAB extraction buffer? Protocols hover around 2.5 molar; if you go over this (e.g. 25 molar), will you saturate your solution, and precipitate the ...