3
votes
1answer
43 views

What sort of seed pod is this?

My son found this floating in a stream in Massachusetts, in the northeastern US. It was intact when he found it, but he cracked it open to see what was inside. I did some Google image searching, but ...
1
vote
0answers
31 views

How does one predict the methylation pattern?

Suppose, we have a double stranded DNA like 5' AGCTAGGAGAGACCAGGTTCC 3' 3' TCGATCCTCTCTGGTCCAAGG 5' Where would the methylated cytosine be? Is there any randomness?
0
votes
0answers
52 views

Hemiptera sp. nymph?

Hemiptera sp. nymph? Which species is this Hemiptera nymph? Thank you!
0
votes
0answers
51 views

Hemiptera sp preimago?

Which species of Hemiptera is this preimago, seen in 2015 in Rome?
2
votes
1answer
50 views

Where does the inverse seconds unit come from in the association constant?

I'm working to determine Kd(s) kinetically by generating association and disassociation curves. Kon (association constant, or on-rate) is in inverse seconds multiplied by inverse molar. I get that ...
1
vote
0answers
47 views

Protein modification and ATP consumption

According to wikipedia there exists a lot of ways to modify a protein (post-translationally). Just to mention few: phosphorylation, dephosphorylation, glycosylation... While phosphorylation requires ...
1
vote
0answers
15 views

E.coli division and its DNA replication [duplicate]

E.coli divides in 20 minutes and its DNA replicates in 38 minutes .Kindly explain.
1
vote
1answer
48 views

What are the key differences in giant and large unilamellar vesicle preparation processes?

I have to study my peptide's folding on membrane mimetic (model membrane) by circular dichroism spectra. Now I'm looking for suitable methods for preparation of vesicles: LUV, SUV, GUV- large, small ...
1
vote
0answers
15 views

Serotonin activity with short 5-HTT promotor region and depression

So after reading a few studies (1,2) it seems that a shorter promotor region for the serotonin transport protein may be associated with increased likelihood of developing depression after stressful ...
5
votes
1answer
208 views

What kind of tortoise is this?

Can you help me to ID this tortoise? It was walking around near to my house and then my mom found it, so we'd like to know more info. Its Straight Carapace Length is about 5+ inches. Found it in ...
4
votes
1answer
53 views

What was Protein G named after?

Protein G (the bacterial antibody binding protein) is often used to pulldown antibodies, for example in chromatin immunoprecipitation (ChIP) experiments. However, I was unable to find a site ...
2
votes
0answers
26 views

How to determine suitable Cysteine mutations?

In the lab, I'd like to generate a dimer of a protein via disulfide bonds. The interface between the two looks as follows: Now, in the interface, there isn't any cystein I could use to dimerize the ...
0
votes
1answer
1k views

How to write 100% phenotype ratio? [closed]

I am not quite sure how to write 100% out come for the phenotype ratio after using "Punnett Square". The result from the each alleles, the dominant allele completely(100%) took over the recessive ...
3
votes
2answers
1k views

Why are viruses considered microbes?

My question is simple. Why is a virus considered a microbe? Considering a microbe is considered to be a "living" unit of life, which viruses are not.
1
vote
1answer
242 views

Are mitochondria alive? [duplicate]

I'm working on an assignment for my IB biology class and some assistance would be highly appreciated. I've read several articles and I still haven't quite gotten the answer I'm looking for. I have to ...
2
votes
1answer
98 views

Does opening the lid of the spectrophotometer affect my results?

If I'm performing an experiment using a spectrophotometer and I mistakenly forgot to close the lid on the spectrophotometer, would that affect my results?
0
votes
2answers
2k views

What is the effect of the wavelength on the spectrophotometric measurements of protein?

Does the wavelength setting affect the absorbance reading of a spectrophotometer? For example, if I am using a spectrophotometer at 550 nm to determine the protein concentration of my samples, would ...
0
votes
1answer
60 views

Why is it important to have a restriction point? (G1-S phase control)

Why have eukaryotes evolved to control G1-S phase? Surely if you could control G2-M phase very well, you will not get an excessive proliferation? Thanks for your help.
7
votes
1answer
69 views

What happened to this seashell?

We found this seashell on a Mediterranean beach in the south of France. While most of the shells we found were quite intact, this one caught our attention. It is light and littered with tiny holes, ...
5
votes
1answer
415 views

What is this Sacrificial Reproductive Strategy Called?

The reproductive strategy of salmon is 'suicidal'. Before breeding the males metamorph permanently into a form suited for the breeding season but unsuited for survival. The females devote so much of ...
1
vote
1answer
78 views

Why isn't the biological niche occupied by whales instead occupied by fishes?

As by the title. Why aren't there many more, and larger, whale shark like creatures instead of the great mammalian swimmers? I'd assume fish have a benefit in doing the whole "being under water" thing ...
-6
votes
1answer
83 views

Two 20 million yr old fossils of Hummingbirds found "The amazing thing about the fossil is that it's essentially a modern hummingbird

does this only mean that the Hummingbird is perfect in creation and needs no change to survive? http://news.bbc.co.uk/2/hi/science/nature/3691169.stm
1
vote
2answers
161 views

How does the sticky ends of foreign gene bind with its counterpart in the plasmid DNA if positions are not matching?

Consider a foreign gene with recognition sequence as GAATTC for EcoR1. Now suppose that it is being cut at two palindromic sequence to form sticky ends. Here the sticky ends are formed such that ...
1
vote
0answers
21 views

How do we sneeze? - Part 2

Here is the second part of my question about how we sneeze. How are the sneeze droplets propelled at such a fast speed? I have heard sneeze travels at 100 mph. How is this possible?
3
votes
2answers
128 views

How do antibiotics create drug-resistant strains

I've heard for years that low-level use of antibiotics causes the spread of drug-resistant strains of bacteria, but the explanations always fall short. I understand mutations and natural selection, ...
0
votes
0answers
39 views

What cures pineapple burns?

If you already ate too much bromelain in pineapple, how do you cure your tongue burn?
3
votes
2answers
136 views

Is there a database of cell images?

We're working on an algorithm for processing images of cells, similar to but much more basic than Cell Profiler, and we are looking for a large database of cell images to test our software. Can anyone ...
0
votes
0answers
238 views

When does meiosis occur in flowering plants?

At what point in the development of a flower does meiosis occur?
3
votes
1answer
54 views

What is meant by “the degree to which a gene is expressed” in an individual?

Here is an excerpt from a text that I was reading, Here is an example of microarray data. The idea is to take a group of different individuals and for each of them, you measure how much they ...
0
votes
1answer
69 views

What happens to H+ when Glycerate 3-Phosphate is converted to Triose Phosphate?

The conversion from Glycerate 3-Phosphate to Triose Phosphate requires: $ATP \rightarrow ADP + P_i$ $NADPH \rightarrow NADP + H^+$ So what happens to the $H^+$? Is it in-effect "recycled" back to ...
1
vote
1answer
73 views

What are the metabolic concerns associated with hard water?

If humans can maintain a consistent blood pH, then what problems does alkalized water cause us? Why is it recommended that we filter and boil hard water? Is the issue that hard water can affect the ...
0
votes
1answer
31 views

Nucleoside analogs that cause mutation

I'm confused with this explanation in my book: 2-aminopurine is incorporated into DNA in place of adenine but can pair with cytosine, so an AT pair becomes a CG pair. This sentence seems odd to me. ...
1
vote
0answers
32 views

Is there a good easy protocol for extracting proteins(enzymes) from fungal mycelium?

I quantify the enzyme (polygalacturanase)activity by DNSA method.To determine endo-polygalacturonase activity I'm searching for a good easy enzyme extracting method.Any suggestions for a suitable ...
1
vote
0answers
32 views

how often do the various organ cells regenerate? [closed]

Is there an Internet source that states how often human organ cells (eyes, kidneys, liver, heart, pancreas, skin, etc.) regenerate? I'm seeking specific data for every human organ.
1
vote
0answers
30 views

How do we sneeze? - Part 1

For some time I have been thinking about how we sneeze. I have divided my thoughts into two questions. My first question is when a stimuli triggers the sneezing pathway, known as the trigenimal nerve ...
1
vote
1answer
83 views

Why do we blow when we're out of breath? [closed]

When people are out of breath from exercising, instead of breathing normally they partially obstruct their expirations by blowing out instead of breathing out. Why is this? EDIT: This photo ...
12
votes
1answer
573 views

How heavy are all foreign microorganisms in and on the human body?

I define "foreign microorganism" as a microorganism which is not produced by the human body (not antibodies or leukocytes) including bacteria, viruses, fungi, biofilm aggregates or small lifeforms ...
2
votes
1answer
59 views

What dangers would the wireless transmission of power through microwaves pose to living organisms?

If we were one day able to harness the power of "wireless electricity", and INTEGRATE it into society, what disadvantages and/or dangers to living organisms would become relevant at that point? To my ...
0
votes
2answers
63 views

Can we change one's genome into the genome of somebody else

If I (grown-up individual and not just an egg after fertilization) wanted your exact genome, would we be able with today's technology to change my genome into yours?
2
votes
2answers
135 views

Reading and Understanding profile bands in DNA Fingerprinting

I have very limited knowledge when it comes to DNA fingerprinting. I know about the technique gel electrophoresis and how everything is carried out. But I don't know how to read the result or ...
5
votes
1answer
147 views

Insect ID, Maharashtra, India

could someone please identify this insect? This photograph was taken in the Western Ghats of Maharashtra, India, near the town of Mahabaleshwar. Hemiptera was about as far as I could get using other ...
10
votes
1answer
421 views

Insect identification, Chennai, India

could someone tell me what the name of this beautiful insect is? Location: Chennai, India. Thank you!
-1
votes
1answer
90 views

Will moths evolve to become blue if we paint walls in blue?

I know dark moths are more frequent than white moths when the environment is full of dirty (dark) walls/trees; it is a consequence of natural selection. Will moths evolve to become blue if walls/trees ...
2
votes
0answers
30 views

“Antibiotic resistance” equivalent in archaea for selection during cloning

I'm beginning to work with halophilic archaea and I'm trying to figure out a good way to select for cells that have taken up a plasmid. Obviously, one can't use antibiotic resistance since they are ...
5
votes
1answer
49 views

Does the human body metabolize what it smells, even in trace amounts?

I conjectured to a friend that some small amount of anything we smell is likely metabolized by the body. He disagreed. My thinking is that, if you are smelling something, some portion of molecules are ...
0
votes
0answers
27 views

Effect of cellular phone towers on human health

We live in world of mobiles, tablets, PCs and other electronic gadgets. We are continuously exposed to radio frequencies and other cellular frequencies. Generally these all waves are with very low ...
1
vote
0answers
33 views

Since nature highly favors the pyranose forme of Ribose, what explains the fact we find it in the form of furanose in DNA and RNA?

I read in my notes that relative abundance of ribopyranose represents about 80% of all ribose in solution (including the alpha and beta anomeres). I'm curious as to why evolution favored the use of ...
2
votes
1answer
53 views

How to correctly and accurately identify a few species of trees from their leaves(including multiple leaves and part of the branch)?

I want to identify a tree from one of the 12 species listed based on observing their branch and leaves. Is there quick and neat way to do it? Red Oak, White Oak, Red Maple, Striped Maple, Tulip ...
6
votes
1answer
76 views

Why doesn't telomerase activity cause DNA to get longer each time a cell undergoes DNA replication?

Telomerase extends the ends of the lagging strands in order for all of DNA to be be copied. Doesn't this also mean that DNA gets progressively longer each time it undergoes replication? Why is this ...
0
votes
1answer
68 views

which organelle produce glycogen phosphorylase and why

I know that Glycogen phosphorylase doesn't produce from rough endoplasmic reticulum in liver cell. But almost every proteins such as insulin receptor, serum albumin, and lysosomal enzyme have to ...

15 30 50 per page