Tag Info

New answers tagged

-1

Given an RNA sequence like the microRNA from arabidopsis ath-MIR447a ath-MIR447a MI0002407 CAUUCUUAAUAUAUAAUACUACUUUUUCAUCCAUUAAACCCCUUACAAUGUCGAGUAAACGAAGCAUCUGUCCCCUGGUAUUGUCUUCGAGCUUGGUGUUUUUUUCUAGCCAACUCCAAGUUCUCGAGUUGAUCAUUGUUUGUAUUCUUGAGACAUUAUUUGGGGACGAGAUGUUUUGUUGACUCGAUAUAAGAAGGGGCUUUAUGGAAGAAAUUGUAGUAUUAUAUAUCGAGAGUG You can find its ...


0

You can convert the $\Delta G$ values into equilibrium constants $K$ using the formula $$ \Delta G = R T \ln K $$ This might help you understand what those energies roughly mean. But the more important and also more difficult part is judging how good your predicted free energies actually are. I assume you used a secondary structure prediction program like ...


1

A base pair between two adjacent bases i,j. It is not possible. To form an intramolecular hydrogen bond, the RNA has to bend. The persistence length i.e. the minimum length of the chain required for bending, is around 4 bases for ssRNA (I am not very sure about this number. At this moment I am not able to locate the exact reference. I remember this ...


3

By far the most common type of base pair is the Watson-Crick base pair in an RNA helix. Those are comparably easy to predict, e.g. Mfold and the Vienna RNA package can do this. Base triples, three nucleobases that form hydrogen bonds to each other are not uncommon in RNAs with a complex tertiary structure. There is even a database of RNA triples, though ...


3

Measuring the electrical signals (=nerve signals) from the heart is frequently done in medicine, it is called electrocardiography. It looks like this (from the same article): Influencing the heartbear can also be done and is done by pacemakers. Depending on the patients necessities the can permanently stimulate the heart or do this only, when certain ...



Top 50 recent answers are included