New answers tagged microbiology
0
Here's my take, just a few minor changes which are shown in bold (I have also changed ,to . for decimal numbers and added a few spaces where needed):
PCR Amplification and sequencing
A PCR reaction for sequencing was performed using universal primers ITS5: F:
(5’TCCTCCGCTTATTGATATGC3’) and ITS4:R: (5'TCCGTAGGTGAACCTGCG C3'),
including 5.8 S rRNA ...
2
As you probably know, there is a lot of literature on the correlation between Streptococcus bovis and colorectal cancer, but very little on possible mechanisms.
In an editorial (Streptococcus bovis: Causal or incidental involvement in cancer of the colon? in the International Journal of Cancer 119(9):xi-xii), Harald zur Hausen referring to this paper:
...
1
Oblong is probably correct in this context, but "allantoids" should probably be "allantoid" to be the adjective form. It's describing translucent (hyaline), oval (oblong) to sausage-shaped (allantoid), undivided (aseptate) spore.
3
The nature of infectious agents is that they transmit between organisms. This means that they have reservoirs outside a single host, and hence of course reinfection with the exact strain is possible if this strain leaves the body and at a later stage is carried back to it. This could typically happen for example with the common influenza, spreading from one ...
0
According to the Marine Species Identification portal, the presence of these thorns is variable. They also vary in size, shape, and the presence of polygonal frames. I don't think there is anything about the imaging process described that would result in the uniform loss of spines (unless the sieve/microsplitter broke them all, but I think that would be a ...
Top 50 recent answers are included
