Hot answers tagged

7

There is no standard software, programming language, or library used for computing and graphing biological data. The R language is commonly used for statistical work, but Python (in conjunction with the SciPy stack) and C++ also gets used a lot. Before going further, I should point out you are asking two questions. One about computation and the other about ...


5

Yes, tRNA can form dimers. For example it was shown that E. Coli tRNA GCC forms homodimers, i.e. two identical molecules interact with each other. In this case the dimerization occurs between the anti-codon loops (what was probably meant with UUU and AAA). References: Sequence and structure of naturally-occurring tRNA transcripts and site-directed ...


4

A biomarker, or biological marker, generally refers to a measurable indicator of some biological state or condition. - Wikipedia The presence of certain 'things' (sorry for being vague) in a tissue obtained invasively - via biopsy, for example - are considered biomarkers for, say, a cancer. It could be histopathological - a particular abnormality seen ...


3

With many non-coding RNAs, the RNA is the functional endpoint. Therefore, ncRNA "expression" simply refers to the production of that functional component. Similarly to with proteins, this involves looking at differential tissue production of that noncoding RNA (i.e. in which tissues the RNA is produced). Gene expression is defined in the Oxford Dictionary ...


2

Flaccidity in plant cells The failure to display turgidity especially as seen with plant cells. The suspension of cells from plants in isotonic solutions results in the state termed flaccidity. On a cellular level it represents a lack of pressure of the plasma membrane against the plant cell wall. A more extreme state, termed plasmolysis, is seen ...


2

I have also come from purely non-Bio background (I am a Software/Electrical engineer who didn't study Bio even in his high-school). As others have pointed out in comments above that Molecular Biology is a vast field. But if you want resources covering all the basics of Genetics/Molecular Genetics, then I can easily recommend the following to anyone (which ...


2

RNA and proteins are not electrical systems, but the idea of translating a signal between incompatible systems can be applied here. Proteins are made through a process called Translation, where instructions stored in a piece of mRNA are used by the Ribosome to make protein. tRNAs adapt the mRNA nucleotide sequence into a protein's peptide sequence by ...


1

The protein doesn't move towards anything. It just randomly diffuses (bounces around) in the cell until it sticks to something. The particular chemical structure (the shape) of the protein and whatever it hits will determine how tightly they stick together and whether or not a chemical reaction occurs. A way to imagine this is to think of a jar filled with ...


1

Word "arranged" means simply alignment of sequence based on overlapping regions in two sequences. For example: Seq1: AGTGTCCGTCGTAAGTCA Seq2:GTCGTAAGTCATCGAGATACC leading to: Seq12: AGTGTCCGTCGTAAGTCATCGAGATACC Maybe he used the word "arrange" as overlapping determines the direction of resultant sequence (for which word alignment is sufficient) ...


1

Sticking my neck out (and expecting it to be bitten by a black swan) it appears that all the examples of toxins secreted by bacterial pathogens when they infect an animal host (exotoxins) are proteins. However fungi secrete a variety of exotic (and often very nasty) small non-protein molecules (mycotoxins). It’s not clear from the question whether you ...


1

‘Reversible’ and ‘Irreversible’ are standard designations in enzyme kinetics. It may be that your instructor was using the word in this sense. As already commented, irreversible inhibitors bind the enzyme in such a way that they don't dissociate from it. Either they form a covalent bond or their affinity for the binding site is extremely high. Reversible ...


1

They queried publications dealing with the lncRNA that studied whether it was functional through over-expression or knockdown. Cells do something measurable in their normal state, that can be observed through microscopy, qPCR, microarray, etc. You use the data as a control which to compare experimental results against. For an over-expression study, for ...


1

Your question included "other forms of waves" so I'm going to assume that the use of ultrasound to destroy cancer cells qualifies. A paper published in the British Journal of Cancer in 2009: "[High-intensity-focused-ultrasound in the treatment of primary prostate cancer: the first UK series]"1 describes the use of a "Sonablate 500" device used to treat 172 ...



Only top voted, non community-wiki answers of a minimum length are eligible