New answers tagged

0

I suggest you to try Recursive Directional Ligation. It is meant to do exactly what you are aiming for, i.e. to "polymerize" short DNAs into a longer one. You can find the protocol here http://pubs.acs.org/doi/abs/10.1021/bm015630n


2

The lifetime of Calcium can be considered infinite in biological time scales, it is not a real biomolecule. The half-life time of other biomolecules like IP3, PIP2, receptors, hormones, etc. is species-dependent and within the species strongly depending on the cell and its metabolic state. Short answer: There is no overview for lifetimes of biomolecules. It ...


0

I don't think that computer modeling will be the way new antibiotics in the near future are discovered. Besides all the issues with modeling itself as mentioned above, it's also really easy to find something that kills bacteria (semi-relevant XKCD: https://xkcd.com/1217/), but you really need something that's also mostly harmless to human cells. So you'd ...


1

A retransformation should get you a pure plasmid. Transform the plasmid mix into empty E.coli (don't use too much DNA), plate on Kan / Amp depending on what you need. The probability that one cell took up both plasmids is extremely low, and you could check with colony PCR just to be sure. Otherwise: ask around, there must be (old) stocks of the single ...


2

Was it by chance? Yes, sometimes, Penicillin was discovered by chance (and good observation), see http://www.nobelprize.org/nobel_prizes/medicine/laureates/1945/fleming-bio.html. I know some where accidents, but how are the majority found, testing lots of chemicals on your target? Other important classes, like tetracyclines, were discovered by ...


2

RNA and proteins are not electrical systems, but the idea of translating a signal between incompatible systems can be applied here. Proteins are made through a process called Translation, where instructions stored in a piece of mRNA are used by the Ribosome to make protein. tRNAs adapt the mRNA nucleotide sequence into a protein's peptide sequence by ...


1

The protein doesn't move towards anything. It just randomly diffuses (bounces around) in the cell until it sticks to something. The particular chemical structure (the shape) of the protein and whatever it hits will determine how tightly they stick together and whether or not a chemical reaction occurs. A way to imagine this is to think of a jar filled with ...


6

Yes, tRNA can form dimers. For example it was shown that E. Coli tRNA GCC forms homodimers, i.e. two identical molecules interact with each other. In this case the dimerization occurs between the anti-codon loops (what was probably meant with UUU and AAA). References: Sequence and structure of naturally-occurring tRNA transcripts and site-directed ...


0

I haven't started it yet, but practical computing for biologists by Haddock and Dunn might be a good place to start. Its what I will use for my Bioinformatics class. This course looks at large sets of genomic data and seeks to use analytical programs to parse out the data into codons, genes, single nucleotide polymorphisms, and mutations. If you can write a ...


2

I have also come from purely non-Bio background (I am a Software/Electrical engineer who didn't study Bio even in his high-school). As others have pointed out in comments above that Molecular Biology is a vast field. But if you want resources covering all the basics of Genetics/Molecular Genetics, then I can easily recommend the following to anyone (which ...


0

Yes, it is perfectly possible for both pairs of non-sister chromatids to cross over in a single tetrad. The "standard textbook" depiction is a simplification, true tetrads can sometimes be very complicated and the nested crossing-over would be difficult for entry-level textbooks to cover. This microscope image clearly shows two chiasmata occurring on two ...


1

Word "arranged" means simply alignment of sequence based on overlapping regions in two sequences. For example: Seq1: AGTGTCCGTCGTAAGTCA Seq2:GTCGTAAGTCATCGAGATACC leading to: Seq12: AGTGTCCGTCGTAAGTCATCGAGATACC Maybe he used the word "arrange" as overlapping determines the direction of resultant sequence (for which word alignment is sufficient) ...


2

Flaccidity in plant cells The failure to display turgidity especially as seen with plant cells. The suspension of cells from plants in isotonic solutions results in the state termed flaccidity. On a cellular level it represents a lack of pressure of the plasma membrane against the plant cell wall. A more extreme state, termed plasmolysis, is seen ...


1

Sticking my neck out (and expecting it to be bitten by a black swan) it appears that all the examples of toxins secreted by bacterial pathogens when they infect an animal host (exotoxins) are proteins. However fungi secrete a variety of exotic (and often very nasty) small non-protein molecules (mycotoxins). It’s not clear from the question whether you ...


1

Your question included "other forms of waves" so I'm going to assume that the use of ultrasound to destroy cancer cells qualifies. A paper published in the British Journal of Cancer in 2009: "[High-intensity-focused-ultrasound in the treatment of primary prostate cancer: the first UK series]"1 describes the use of a "Sonablate 500" device used to treat 172 ...


4

A biomarker, or biological marker, generally refers to a measurable indicator of some biological state or condition. - Wikipedia The presence of certain 'things' (sorry for being vague) in a tissue obtained invasively - via biopsy, for example - are considered biomarkers for, say, a cancer. It could be histopathological - a particular abnormality seen ...


1

‘Reversible’ and ‘Irreversible’ are standard designations in enzyme kinetics. It may be that your instructor was using the word in this sense. As already commented, irreversible inhibitors bind the enzyme in such a way that they don't dissociate from it. Either they form a covalent bond or their affinity for the binding site is extremely high. Reversible ...



Top 50 recent answers are included