New answers tagged

1

Apart from the polycistronic case there is another possibility of one mRNA yielding multiple proteins. By one mRNA, I mean that the RNA is not in any way altered because of RNA editing or other mechanisms. Translation can be initiated at alternative sites leading to production of different protein products (Touriol et al., 2003). VEGF is one of the genes ...


3

I believe, your book refers to polycistronic mRNA. This is mRNA where multiple genes are encoded together in one mRNA and are often (but not necessarily) translated one after another. This is mainly found in prokaryotes where the proteins encoded on the same mRNA often form a metabolic pathway together.


1

You can come at mRNA from two directions. Remember that human genes are largely monocistronic, in other words they often code for a single protein. If we look at prokaryotes, however, polycistronic genes such as those in operons are very much possible. From a single lac mRNA you can get multiple proteins. For humans with monocistronic genes, you can code ...


0

The only strategy close to your suggested description is based on FUCCI sensors. Fluorescent markers designed so that their presence informs of specific stages of the cell cycle, in principle without disrupting or perturbing cell progression. So, although there is not a physical clean-up of pure cell sub-populations, these can be tracked by the abundance of ...


0

From wikipedia If the genetic pattern of homozygotes can be distinguished from that of heterozygotes, then a marker is said to be co-dominant. This definition seems to be different from the one used to explain allelic effects. For example, as you would know a SNP is basically a feature of the DNA sequence. It is more of a genotype rather than a ...


1

As I understand your question, you ask about genetic mapping which has been demonstrated in the HGP (human genome project). The human genome project: enabled humans to find the gene responsible for relatively rare, single-gene inherited disorders such as cystic fibrosis and Duchenne muscular dystrophy is useful in guiding scientists to the many genes ...


3

I would say that first exception might be White gene in Drosophila Melanogaster, described in 1910 by Thomas Hunt Morgan and Lilian Vaughan Morgan. At least, is the first exception we study in genetics since sex linkage its so fundamental. These experiments established the chromosomal theory of inheritance. Thomas Hunt Morgan, an embryologist who had ...


2

The first exception to Mendelian genetics was probably discovered by Mendel. As a followup to his pea experiments, Mendel used hawkweed, in which his rules do not seem to apply due to some unusual aspects of hawkweed development; see Apomixis in hawkweed: Mendel's experimental nemesis for details. Mendel eventually abandoned his biological experiments, ...


1

It is assumed that in order for a cell to divide it must progress through a series of gradual stages. At each of these phases certain proteins have to be manufactured through mRNA and/or modified post-transcriptionally in order to serve an specific proliferative or anti-proliferative role, which overall eventually orchestrates the transit to the subsequent ...


3

Is there evidence of selection against long proteins and long genes? I am not aware of any such evidence and cursory googling did not reveal studies that researched a correlation between gene selection and gene size. However, the larger a gene, the larger the probability of a deleterious mutation within said gene so I expect that there is some limit to ...


1

Even simpler: If you are lucky and your target Gastropoda is in Ensembl (http://ensemblgenomes.org/) you can just introduce the gene ID and see if it has any paralogs. A lot of other info is available for each gene.


1

The simple way to do this is to use blast to search the genomes your interested in for sequences similar to your gene. If there's another copy it'll turn up in the blast results (so will orthologous genes - but they'll have lower scores than an actual copy). That relies on the annotation and genome being correct, of course.


3

To add to Remi b's answer - this question is confusing because 'null' and 'recessive' are terms emerging from two very different levels of analysis. The concept of 'recessive' existed before we knew what genes were, or how they worked. It just describes the patterns of inheritance you see in a gene's effects. The concept of a 'null' allele however came ...


0

Basically, a recessive allele leads to formation of a product that has a low activity or no activity, which is complemented in the presence of the dominant allele (there can be effects related to dosage, in some cases). This can be easily understood in terms of an enzyme; a dominant allele would code for an enzyme with full activity whereas the recessive ...


2

Good question +1. Unfortunately, the mechanisms by which dominance work is relatively poorly understood and it is likely that the mechanism differs from one locus to another. You might want to have a look at the posts Why are some genes dominant over others? What is the mechanism behind it? Evolution of dominance or some papers such as Llaurens et al. ...


1

Word "arranged" means simply alignment of sequence based on overlapping regions in two sequences. For example: Seq1: AGTGTCCGTCGTAAGTCA Seq2:GTCGTAAGTCATCGAGATACC leading to: Seq12: AGTGTCCGTCGTAAGTCATCGAGATACC Maybe he used the word "arrange" as overlapping determines the direction of resultant sequence (for which word alignment is sufficient) ...


7

(For the direct answer to your question skip to the end!) Genetic linkage can affect the spread of other genes. The degree of linkage, affected by the rate of recombination between the point (nucleotide, gene etc.) directly under selection and the other point. If the rate of recombination between to given points is low then linkage between them is high and ...


5

Genetic hitchhiking / genetic draft From wikipedia Genetic hitchhiking, also called genetic draft or the hitchhiking effect, is when an allele changes frequency not because it itself is under natural selection, but because it is near another gene on the same chromosome that is undergoing a selective sweep. The term "selective sweep" is used improperly ...


4

A biomarker, or biological marker, generally refers to a measurable indicator of some biological state or condition. - Wikipedia The presence of certain 'things' (sorry for being vague) in a tissue obtained invasively - via biopsy, for example - are considered biomarkers for, say, a cancer. It could be histopathological - a particular abnormality seen ...


1

They queried publications dealing with the lncRNA that studied whether it was functional through over-expression or knockdown. Cells do something measurable in their normal state, that can be observed through microscopy, qPCR, microarray, etc. You use the data as a control which to compare experimental results against. For an over-expression study, for ...


3

With many non-coding RNAs, the RNA is the functional endpoint. Therefore, ncRNA "expression" simply refers to the production of that functional component. Similarly to with proteins, this involves looking at differential tissue production of that noncoding RNA (i.e. in which tissues the RNA is produced). Gene expression is defined in the Oxford Dictionary ...



Top 50 recent answers are included