Tag Info

Hot answers tagged

7

The RNA world hypothesis states that self-replicating RNA (that is, an autocatalytic RNA polymerase) was the first form or precursor of life. So, in that context, your question is basically asking how life originated. The obvious answer is that we don't know (currently anyways), but I'm going to take this opportunity to describe a few really neat experiments ...


6

The question is a bit vague in some important parts, so I'll have to make a few assumptions about what the authors likely meant. RNAses are enzymes that degrade RNA. There are a few different ones that lead to different kinds of degradation. The type that you would use in an experiment like this is an RNAse that completely degrades RNA. The purpose of this ...


6

The helix shape of DNA molecule is a consequence of its secondary structure. This refers to the bases contained in the molecule which pair, thus determining tertiary structure [1]. Basepairing also occurs in RNA, so it can form a double helix. In fact, RNA is composed of short helices packed together [2]. Base pairs maintain DNA's helical structure no ...


6

RNA (single or double stranded) actually can and does form a helix in the absence of certain complex 3D structures. The RNA helix is typically A-form, as opposed to B-form for typical DNA. The A-form helix is right-handed like the B-form but is more compact (2.6 Å rise versus 3.4 Å) and wider (26 Å diameter vs 20 Å). The differing helices arise from the ...


5

Yes, you can find mutations in the genomic DNA which affect splice acceptor sites. Wikipedia lists the following outcome: Mutation of a splice site resulting in loss of function of that site. Results in exposure of a premature stop codon, loss of an exon, or inclusion of an intron. Mutation of a splice site reducing specificity. May result in variation in ...


4

Both the DNA and the RNA polymerase complexes moves along the DNA molecule like it was a track. While the new mRNA is big, it would never be as big as the whole genome, so the reference point is the DNA molecule. Plus, the functioning of the movement of this enzymes is quite similar to other proteins that move "climbing" long polymers, such as actin polymers ...


4

Genes controlled by bidirectionl promoters are in head-to-head configurations, meaning that their 5' ends are facing one-another. Remember that DNA is double stranded, so this means one gene is on the 'top' strand and one gene is on the 'bottom' strand. Check out the diagram below, genes are in capitals, bidirectional promoter in parenthesis. Both genes ...


4

I'm not sure this is what you need since the sequences you posted are not actually complementary as far as I can tell. However, exonerate is one of the most powerful tools out there and can do this as well. Using these sequences as examples: >query TAGCTTATTGATGGGAGGAGAGTCCGTGCACATGACAGACCTTGGCTGTCCCAGACTGCAGGAAGCCCAGG >target ...


4

The biotin-streptavidin interaction is extremely strong, one of the strongest (if not the strongest) non-covalent interaction between biomolecules. So you'll need pretty harsh conditions in any case. Extreme pH values are generally a very bad idea for RNA. I'm pretty sure that the conditions you mentioned are not meant for elution of nucleic acids. Such low ...


4

The tRNA is not acting alone, it has the help of the Ribosome. The Ribosome assembles at the beginning of the transcript and starts the translation at the first AUG codon. It then binds the first tRNA which fits to the mRNA. The tRNA is then moved from the A-position to the P-position and the next tRNA is binding (the move around and bind by chance. A ...


4

The difference between RNA and DNA is rather small, and both can form a double-helix structure. So if you had two sequences of RNA complementary to each other they would basepair and form a helix. There were also some ideas to use this for therapeutic purposes, antisense RNA, an RNA oligo complementary to a messenger RNA, can theoretically be used to ...


4

Antisense simply means that a sequence is the complement of another. miRNAs are naturally occurring antisense RNAs yes. The "difference" is that antisense RNA is often used for sequences developed in the lab and used for processes such as RNAi. miRNAs, on the other hand, are encoded by the genome and are used by the cell for regulating gene expression. They ...


4

OK, let us start from the beginning. We know what makes one cell type different from another cell type is its expression - i.e. what genes are actually being transcribed into RNA. Therefore, there should be certain RNA in one cell type that should not exit in another cell type. If you isolate RNA from a certain cell type, say a neuron and you want to show ...


4

Trimming = removing RNA sequences from one end. Splicing = removing introns and joining exons back together.


3

The RNA expression level is an estimate of the amount or proportion a given gene's RNA found in a sample of cells (such as a tissue sample) or even a single cell. Expression is used because the RNA sequence is translated from DNA to RNA according to the signals within the cells. There are various means of estimating this. They often involve a sequence ...


3

Rfam is a database about RNA families, similar to Pfam (wich is for proteins). I think it's what you're looking for. http://rfam.sanger.ac.uk/search You could also enjoy miRbase, a database for micro RNAs: http://www.mirbase.org/ There are tRNA databases, too, like this one: http://trnadb.bioinf.uni-leipzig.de/ And this tool for predict RNA secondary ...


3

There is something called GEO, which is maintained by the NIH and is a massive collection of data obtained from RNA seq, microarray, etc. experiments. One thing you can do is search for a paper that has done what you are looking for. The paper may have a GEO accession number, and you can use that number at the GEO website to find the data you want. You may ...


3

RNA Pol doesn't worry about stop codons. Transcription termination can occur through the formation of a hairpin in the new RNA sequence, or through the action of Rho proteins. A lot of the time prokaryotes have polycistronic mRNAs, that is, mRNAs with multiple protein coding regions. The stop codons are detected during translation, so you will often have ...


3

You could have asked a similar question about splicing. The function of RNA editing seems to be similar: it's one of the ways to trigger production of alternative transcripts and proteins given the same DNA sequence. The question is discussed, for example, in this review. The authors describe different known effects of alternative RNA editing: Amino-acid ...


3

If I understand correctly what you mean by "I would like to dilute my RNA to 100 ug": Your RNA preparation is at 3.3 μg μl-1. To add 100 μg to a reaction you need to add 100/3.3 = 30 μl Then make the total volume up to 1000 μl with enzyme and buffer as appropriate.


3

You can use R-coffee of the T-coffee suite of tools. In general, the *coffee tools are excellent and work very well if you can get over their author's self obsession1. R-coffee can align RNA sequences taking into account structural information: 1 The guy actually adds his name to the output of all his programs! Seriously, he does. Apart from being ...


3

I think that there is no reason in principle why early evolution couldn't have landed on a translation mechanism going 3'>5'. There are, however, clear biochemical reasons why the transcript itself has to be made in a 5'>3' direction. So in this alternative world where the initiation signals would have been at the 3' end of the mRNA, the message would have ...


3

The protocol you are using will not only leave the sample with rRNA but also non coding RNA. Many RNA protocols will separate mRNA by affinity of a carrier to the polyA tail. This protocol references an older paper that estimates that only 5% of RNA is mRNA. I'd be surprised if this ratio changed by more than 2-3 fold in drosophila. I assume that %age ...


3

Transcription always proceeds in the direction 5' (5-prime) to 3' (3-prime) on the coding strand of DNA. Binding of both transcription factors and RNA polymerase to DNA depends on sequence motifs in the DNA. Transcription always happens in the same direction with respect to the chemical structure of the coding DNA strand, while the transcription direction ...


3

By far the most common type of base pair is the Watson-Crick base pair in an RNA helix. Those are comparably easy to predict, e.g. Mfold and the Vienna RNA package can do this. Base triples, three nucleobases that form hydrogen bonds to each other are not uncommon in RNAs with a complex tertiary structure. There is even a database of RNA triples, though ...


3

@MadScientist answer is very good. I just want to add a detail that could not fit in a comment. Double stranded RNA is nothing exceptional. You can see an RNA strand that binds to its antisense in tRNA and in RNAi for example. tRNA RNAi


3

You are almost right. I modified you picture a little bit to answer it: Structure I is indeed DNA, structure II is processed RNA. This is because in I you see loop structures which have no complementary part in the RNA anymore, these are introns (structure Q and the flanking loop regions to P). P is an exon flanked by two introns. The end of the RNA is ...


2

Gergana is right about the effects of the Guanidine isothiocyanate, but not the details there of. Guanidine isothiocyanate absorbs strongly at 260 and NOT 230 (guanidine hcl is the one that absorbs strongly at 230). As such if your RNA is highly contaminated with guanidine isothiocyanate, which is used in at least one buffer in just about every RNA prep ...


2

You've already mentioned rRNA. An interesting review (Tanner, 2006), outlines some more: Group I Introns - self-splicing; "They are abundant in fungal and plant mitochondria..." Group II Introns - some have been shown to self-splice; "...they are found in fungal and plant mitochondria, in chloroplasts of plants, in algae, in eubacteria and especially in ...


2

Just run blast with only the Plus-Minus alignments. See this post in biostar; it is similar to what you are interested in. This is for the standalone version. I am not sure about how to do it in the online blast. If you have just two sequences then you can use UNAfold for checking complementarity.



Only top voted, non community-wiki answers of a minimum length are eligible