Tag Info

Hot answers tagged

6

The question is a bit vague in some important parts, so I'll have to make a few assumptions about what the authors likely meant. RNAses are enzymes that degrade RNA. There are a few different ones that lead to different kinds of degradation. The type that you would use in an experiment like this is an RNAse that completely degrades RNA. The purpose of this ...


4

RNAses are enzymes, and there are various ways to inactivate them. Unfortunately, RNAses are rather stable proteins and autoclaving doesn't completely kill their activity. The common methods to inactivate are unspecific methods that will destroy any enzymes, either through covalent modification or degradation. The most common methods for RNAse inactivation ...


4

precursor miRNA is ~70mer RNA with a stem loop structure. It is cleaved by dicer to generate one or two mature miRNAs (from one or both the 'arms' of the stem ; called 3p and 5p which are ~22nt long). Refer to this review. (It is an old one and some facts might have changed, but the basics are there.) Yes, there can be different precursors giving rise to ...


4

It's hard to know what RNaseZap does since the ingredients list is a trade secret. However, I expect it is a lot more than just detergent. RNaseA is extremely hard to destroy; moreover it can easily renature once the denaturant is removed. Therefore, very minute quantities are sufficient to annihilate RNA experiments. The historical method of purification ...


4

Both the DNA and the RNA polymerase complexes moves along the DNA molecule like it was a track. While the new mRNA is big, it would never be as big as the whole genome, so the reference point is the DNA molecule. Plus, the functioning of the movement of this enzymes is quite similar to other proteins that move "climbing" long polymers, such as actin polymers ...


4

This is rather easy to do if you synthesize oligonucleotides chemically and not enzymatically. This is typically done using phosphoramidite chemistry, and it allows for the synthesis of chimeric RNA/DNA oligos. You can even incorporate modified nucleosides like 2'-O-Me or LNA. This is typically done if you want to change the properties of an oligo, e.g. if ...


4

Genes controlled by bidirectionl promoters are in head-to-head configurations, meaning that their 5' ends are facing one-another. Remember that DNA is double stranded, so this means one gene is on the 'top' strand and one gene is on the 'bottom' strand. Check out the diagram below, genes are in capitals, bidirectional promoter in parenthesis. Both genes ...


4

I'm not sure this is what you need since the sequences you posted are not actually complementary as far as I can tell. However, exonerate is one of the most powerful tools out there and can do this as well. Using these sequences as examples: >query TAGCTTATTGATGGGAGGAGAGTCCGTGCACATGACAGACCTTGGCTGTCCCAGACTGCAGGAAGCCCAGG >target ...


4

Yes, you can find mutations in the genomic DNA which affect splice acceptor sites. Wikipedia lists the following outcome: Mutation of a splice site resulting in loss of function of that site. Results in exposure of a premature stop codon, loss of an exon, or inclusion of an intron. Mutation of a splice site reducing specificity. May result in variation in ...


4

The biotin-streptavidin interaction is extremely strong, one of the strongest (if not the strongest) non-covalent interaction between biomolecules. So you'll need pretty harsh conditions in any case. Extreme pH values are generally a very bad idea for RNA. I'm pretty sure that the conditions you mentioned are not meant for elution of nucleic acids. Such low ...


4

The tRNA is not acting alone, it has the help of the Ribosome. The Ribosome assembles at the beginning of the transcript and starts the translation at the first AUG codon. It then binds the first tRNA which fits to the mRNA. The tRNA is then moved from the A-position to the P-position and the next tRNA is binding (the move around and bind by chance. A ...


3

Rfam is a database about RNA families, similar to Pfam (wich is for proteins). I think it's what you're looking for. http://rfam.sanger.ac.uk/search You could also enjoy miRbase, a database for micro RNAs: http://www.mirbase.org/ There are tRNA databases, too, like this one: http://trnadb.bioinf.uni-leipzig.de/ And this tool for predict RNA secondary ...


3

There is something called GEO, which is maintained by the NIH and is a massive collection of data obtained from RNA seq, microarray, etc. experiments. One thing you can do is search for a paper that has done what you are looking for. The paper may have a GEO accession number, and you can use that number at the GEO website to find the data you want. You may ...


3

RNA Pol doesn't worry about stop codons. Transcription termination can occur through the formation of a hairpin in the new RNA sequence, or through the action of Rho proteins. A lot of the time prokaryotes have polycistronic mRNAs, that is, mRNAs with multiple protein coding regions. The stop codons are detected during translation, so you will often have ...


3

Quick answer: we don't really know. As WYSIWYG said, splice sites do have a sequence signature. The image below (taken from [1]) shows the consensus for human acceptor and donor sites: In the images above, the size of a nucleotide represents its frequency at that location. As you can see, there is a clear signal around the splice sites and this signal is ...


3

The RNA expression level is an estimate of the amount or proportion a given gene's RNA found in a sample of cells (such as a tissue sample) or even a single cell. Expression is used because the RNA sequence is translated from DNA to RNA according to the signals within the cells. There are various means of estimating this. They often involve a sequence ...


3

You could have asked a similar question about splicing. The function of RNA editing seems to be similar: it's one of the ways to trigger production of alternative transcripts and proteins given the same DNA sequence. The question is discussed, for example, in this review. The authors describe different known effects of alternative RNA editing: Amino-acid ...


3

If I understand correctly what you mean by "I would like to dilute my RNA to 100 ug": Your RNA preparation is at 3.3 μg μl-1. To add 100 μg to a reaction you need to add 100/3.3 = 30 μl Then make the total volume up to 1000 μl with enzyme and buffer as appropriate.


3

You can use R-coffee of the T-coffee suite of tools. In general, the *coffee tools are excellent and work very well if you can get over their author's self obsession1. R-coffee can align RNA sequences taking into account structural information: 1 The guy actually adds his name to the output of all his programs! Seriously, he does. Apart from being ...


3

I think that there is no reason in principle why early evolution couldn't have landed on a translation mechanism going 3'>5'. There are, however, clear biochemical reasons why the transcript itself has to be made in a 5'>3' direction. So in this alternative world where the initiation signals would have been at the 3' end of the mRNA, the message would have ...


3

The protocol you are using will not only leave the sample with rRNA but also non coding RNA. Many RNA protocols will separate mRNA by affinity of a carrier to the polyA tail. This protocol references an older paper that estimates that only 5% of RNA is mRNA. I'd be surprised if this ratio changed by more than 2-3 fold in drosophila. I assume that %age ...


3

Transcription always proceeds in the direction 5' (5-prime) to 3' (3-prime) on the coding strand of DNA. Binding of both transcription factors and RNA polymerase to DNA depends on sequence motifs in the DNA. Transcription always happens in the same direction with respect to the chemical structure of the coding DNA strand, while the transcription direction ...


3

By far the most common type of base pair is the Watson-Crick base pair in an RNA helix. Those are comparably easy to predict, e.g. Mfold and the Vienna RNA package can do this. Base triples, three nucleobases that form hydrogen bonds to each other are not uncommon in RNAs with a complex tertiary structure. There is even a database of RNA triples, though ...


2

There are some signature sequence which mark intron-exon boundaries. Usually introns start with a GU and end with an AG. But this feature per-se is not sufficient for splicing; there are other cis-elements such as exon/intron splicing enhancers/silencers [ESE/ESS; ISE/ISS]. Refer this article. Also, there are protein regulators of splicing such as SR ...


2

Knockdown of lncRNA in mammals is not done via RNAi. Instead, one transfers antisense DNA oligos which bind to the RNA. This triggers the action of the RNase H enzyme, which degrades RNA-DNA duplexes. It degrades the lncRNA. UPDATE: For reference, I learned about this from a seminar, and it is not very well documented, but after some literature search I ...


2

All DNA polymerases use an RNA primer during DNA replication - they cannot begin a DNA molecule de novo. Before the primer is removed the newly synthesised strand is an RNA-DNA hybrid. The first deoxynucleotide to be incorporated into the new DNA is added to the 3'-OH of an RNA. Does this count? Added later: this looks like a place to start reading


2

Just run blast with only the Plus-Minus alignments. See this post in biostar; it is similar to what you are interested in. This is for the standalone version. I am not sure about how to do it in the online blast. If you have just two sequences then you can use UNAfold for checking complementarity.


2

Yes, the individual number of exons/introns will vary in a transcript, but what you can do is just count all possible exons of a gene For example, lets say you have an alternative exon in these two isoforms. The XX's are exons XX---XX---XX---XX XX--------XX---XX We would say this gene has 4 exons and 3 introns, even though one isoform only has 3 exons. ...


2

There are three variables being shown here: The amount of time samples were stored in the freezer to allow $^{32}$P decay (x-axis), The length of time samples were allowed to grow in a nonradioactive environment before being frozen (points with different symbols), and The rate of $\beta$-galactosidase production when cells were thawed and grown in the ...


2

Reverse transcriptase, as the name suggests, uses an RNA template to create a DNA transcript (i.e., complement). Once the DNA complement has been made, DNA polymerase is used because it uses a DNA template to produce a DNA complementary strand. In your specific example, HIV contains a positive-stranded, RNA genome. The HIV RT can use either RNA or DNA ...



Only top voted, non community-wiki answers of a minimum length are eligible