3
$\begingroup$

Helllo All 👋!

I am working trying to assemble dsDNA fragments (for further golden gate domestication) via polymerase cycle assembly (PCA). After designing the required oligonucleotides with overlap regions. (Image of the design provided below). Using

NZYProof Green mastermix x2 25 uL Inner Oligonucleotides 2 uL of 1 uM stock Outer Oligonucleotides 2 uL of 100 uM stock

Initial denaturation 95 ºC 2 min Denaturation 95 ºC 30 sec Annealing 62 ºC 30 sec Extension 72 ºC 30 sec Repeated by 25 cycles Final extension 72 ºC 2 min

Olinucleotides design for PCA assembly reaction

After performing the following protocol (based on This one) with a high fidelity polymerase mastermix, the EF gel of PCR products only shows a single "band" corresponding with the oligonucleotides introduced in the reaction. (Ignore the blurred EF gel, it was imaged quite a long time after running the gel).

EF Gel

Any idea of what could actually be going wrong? Should not I observe at least some faint higher molecular weight amplicons?

Thanks in advance for your answers!

Jorge.

UPDATE: Regarding the length of overlap regions, the design considers different overlap sequences length in order to achieve roughly the same Tm for all the overlaping regions. Tm of every overlap has been calculated using the online NEB Tm Calculator tool, and all of them are in the range of 61-63 °C (Considering a Q5 mastermix, which is the closest HiFi polymerase to the one we are currently using )

UPDATE2: After trying the PCA procedure with a "touchdown" approach (reducing annealing temperature gradually after 3 succesive cycles, most of the assemblies has started to show distinctive bands of the desired lenght in the EF Gel. Annealing is a crucial parameter for PCA.

Improve this question
$\endgroup$
2
  • $\begingroup$ I just ran the red/right gray primer overlap sequence (gtgaggacgaaacagcctctacaaataatt) through the NEB Tm calculator at tmcalculator.neb.com/#!/main and got a predicted Tm of 68C. $\endgroup$
    – Armand
    Commented Jun 18, 2021 at 9:15
  • $\begingroup$ Yes! That's actually right. The provided image is the only PCA assembly which features a weird overlap of higher Tm. However the remaining ones (the other two lanes of the EF Gel) are other sequences where all the overlaping regions are between 61 to 62 ºC of Melting temp. $\endgroup$
    – fmjorge99
    Commented Jun 18, 2021 at 22:52

1 Answer 1

Reset to default
3
$\begingroup$

I suspect mispriming due to annealing temp being too low compared to predicted melting temp of overlap regions. As the protocol in your link notes:

(3) Choose annealing temperature wisely. We recommend to use the same as min_Tm by Primerize design, which is usually between 60-64 °C.

(4) Check PCR product on 4% agarose gel. If assembly is unsuccessful with shorter mis-priming products, we suggest try raising the annealing temperature to reduce mis-priming. Alternatively, splitting the assembly into separate sub-pools (i.e. primer 1-4 and primer 5-6) and do an additional round of full assembly (see below).

At first glance, the sample assembly in the linked protocol uses overlap regions of similar length (presumably of similar predicted melting temp as well), while your overlaps vary substantially in length (esp. red primer and bottom right gray primer).

Using the NEB Tm calculator page ( tmcalculator.neb.com/#!/main ), I got the following predicted Tms:

left gray/red primer overlap sequence (ctttccggtctgatgagt) Tm 61C

red/right gray primer overlap sequence (gtgaggacgaaacagcctctacaaataatt) Tm 68C

green/left gray primer overlap sequence (gctcgtataatgtgtggaag) Tm 60C

Based on the much higher Tm of the red/right gray overlap, I'd retry your reaction with annealing temps of 65C and 68C.

Improve this answer
$\endgroup$
6
  • $\begingroup$ Thank you for your advise Armand, we will try to do it this way and check the resutls. However, still being strange for us not to find any other product of higher molecular weight than of the primers by themselves. $\endgroup$
    – fmjorge99
    Commented Jun 18, 2021 at 22:54
  • $\begingroup$ There may be a more general issue with your PCR reaction. It may be helpful to do a positive control reaction where you are doing traditional PCR, with 2 primers amplifying a segment from a template. The linked protocol also suggested breaking the reaction down into 2-primer segments, then doing a final reaction to assemble those overlapping segments. I agree that not seeing products in any of your reaction lanes suggests it's not just an issue with one sequence. $\endgroup$
    – Armand
    Commented Jun 19, 2021 at 5:32
  • 1
    $\begingroup$ I've had experience in the past with impure primer preps that inhibited the reaction, manufacturing residue on wells that inhibited the reaction, and so forth. Positive control reactions that let you verify the reaction components and conditions are all working can help troubleshoot more quickly. $\endgroup$
    – Armand
    Commented Jun 19, 2021 at 5:37
  • 2
    $\begingroup$ Actually, we have already tried to perform other PCR amplifications and those reactions were succesful. Seems that it is not an issue of the PCR mix or impurities within the tubes. We have also performed a "PCA" with only 2 overlaping primers, and the results were similar to the ones posted here. I am starting to think that our HiFi Polymerase buffer leads to lower melting temperatures compared with NEB Q5 (closer to Phusion polymerases), so maybe trying with a Toucdown PCA could worh it. $\endgroup$
    – fmjorge99
    Commented Jun 20, 2021 at 10:33
  • 2
    $\begingroup$ It seems like you've got things covered -- good luck! I know how frustrating it can be when a supposedly simple reaction doesn't work. $\endgroup$
    – Armand
    Commented Jun 20, 2021 at 13:37

You must log in to answer this question.

Not the answer you're looking for? Browse other questions tagged .