0
$\begingroup$

It is in the news that tomatoes with a Sl7-DR2 knockout are being trialed in England, with a view to being commercially grown and available to consumers. While this would be legal in England, it would be illegal in Wales and Scotland, and there are concerns that the food industry may not effectively distinguish between them such that they enter the food chain in these countries.

If one was concerned about that, as I understand it, one could use the sequence given in the paper as a guide sequence (TGTTTCACTGGGCTGGTTTAGC) to detect the presence of a small amount of GM tomato in a pooled product, say tinned tomato's. If one used a conventional next generation sequencing machine costing 6 figures of dollars this would be incredibly sensitive, such that any amount of contamination is likely to be detected (I think). There are a number of different technologies that allow for much cheaper sequencing machines, for example the Oxford Nanopore MinION costing about $1000.

How sensitive are these cheaper sequencing machines, in relation to detecting the presence of a specific allele within a mixed population with many copies of the alternative allele?

$\endgroup$
3
  • 1
    $\begingroup$ I would hope that a similar law would be passed in Scotland, although it is interesting politically as the SNP is in hock to the Greens. $\endgroup$
    – David
    Commented May 25, 2022 at 16:09
  • 2
    $\begingroup$ Surely you would just use PCR, not sequence the whole genome. $\endgroup$ Commented May 26, 2022 at 9:32
  • 1
    $\begingroup$ @PolypipeWrangler's point is correct. To answer the question not asked (What's the cheapest way to detect this sequence?), some kind of direct PCR solution would probably be the answer. You could just do vanilla PCR and run the product on a gel if you had good size standards, you could use a qPCR solution, or you could maybe test it in the field with an isothermal PCR solution. $\endgroup$ Commented May 26, 2022 at 19:31

2 Answers 2

2
$\begingroup$

Note: user @Polypipe Wrangler's comment about using PCR for this application is very pertinent. My answer is mostly about distinctions in sequencing technology.

Cost

An important distinction is between cheaper machines and cheaper sequencing.

You can buy time/services on instruments owned by service providers, and in that comparison Illumina remains a cheaper option (MinION is actually one of the more expensive options per sequencing run).

The upfront cost of the instrument, while relevant, is ultimately not the practical point of comparison between these different methods.

Sensitivity

Either instrument is roughly comparable at this point for finding a given sequence per sequenced base. Illumina is still more accurate, but with bioinformatic advances you can overcome that limitation pretty easily.

The advantage of Illumina comes in that it provides many more sequenced bases- that is where your sensitivity comes from. You will have to run a lot of MinION flow cells to get comparable numbers of reliable bases compared to Illumina.

For specific information about estimating limits of detection for high-throughput sequencing, see here. The short version is that detection of a given chromosomally integrated sequence in a sequencing run should be excellent, assuming that the sequence's copy number is comparable to chromosomal copy number.

$\endgroup$
1
$\begingroup$

I would start by pointing out that PCR-based detection methods are generally found to be more sensitive and specific than sequencing for applications like this one. (see reference). While qPCR methods are still considered the gold-standard for genetic detection, digital PCR (dPCR) has several advantages and can often achieve greater sensitivity and specificity.

Ultimately, the sensitivity depends on the sequencing depth and assay design. Speaking from experience in methods development and validation for pathogen detection in complex biological specimens, even massively high-throughput next-gen sequencing systems like Illumina MiSeq or HiSeq platforms don't really match the sensitivity of PCR-based detection method unless you implement them with some form of target enrichment, like hybrid-capture probes.

And in terms of cost, a standard endpoint PCR or qPCR will probably win out each time, if you're only interested in the one target. Especially if you factor in the target enrichment, which usually involves some kind of amplification using a thermocycler like the ones you use for the PCR detection anyway. The one area where a targeted sequencing approach might make sense is if you were screening for large panel of different targets in each sample, which doesn't seem to be the case here.

$\endgroup$

You must log in to answer this question.

Not the answer you're looking for? Browse other questions tagged .