0
$\begingroup$

Maybe I'm missing something very obvious but I can't seem to understand how to find the template strand given a sequence and its complementary strand if both strands contain ATG from 5' -> 3'. Consider the following example of a DNA sequence:

5′ TCAATGAGCTGCCTTCATTAA 3′

3′ AGTTACTCGACGGAAGTAATT 5′

I can find ATG in the top strand from 5' -> 3' but also in the bottom strand when reading it 5' -> 3'. I usually try to find the start and then know that it will have to be the coding strand, but I'm lost in this scenario.

The sequence is originally from an exercise where the given sequence has a mismatched A - A mutation. This is the original sequence:

5′ TCAATGAGCTGCCTTCATTAA 3′

3′ AGTTACACGACGGAAGTAATT 5′

If we check what would happen if either the top or bottom Adenine was replaced with a Thymine, we would get different types of mutations. This was just an example sequence I thought would be alright to set the stage for a start codon on both the top and bottom.

$\endgroup$
4
  • $\begingroup$ Welcome to Biology StackExchange! Can you please explain a bit more what these sequences are? Do you have a DNA sequence or mRNA sequence? Note that the coding/template strand identity is determined by the promotor for each gene separately! Without knowing the location (direction) of the promotor, you cannot determine which of the two strands is the coding one. $\endgroup$
    – Domen
    Commented Mar 22 at 14:39
  • $\begingroup$ I see you edited the question and added "DNA". But still: Where did you get this sequences from? Have you read my comment about the promotor? $\endgroup$
    – Domen
    Commented Mar 23 at 12:39
  • $\begingroup$ Is this some sort of contrived homework problem? $\endgroup$
    – David
    Commented Mar 24 at 10:45
  • $\begingroup$ Maybe I'm misunderstanding something or the exercise was a bad example, but just in general, I have trouble identifying the template strand, and all the answers I can find tell me to look at directionality. But my question is: what if both strands have a start codon when reading from 5' -> 3'? Doesn't that mean both have 'correct' directionality? So how would I know which to pick? And in regard to Domen's comment, the location of the promoter is unknown for these problems, but we were told to identify an ORF for which I need to know which is the template or coding strand, right...? $\endgroup$
    – Naumhat
    Commented Mar 24 at 12:15

1 Answer 1

1
$\begingroup$

In real life, you can't predict the start of a protein by looking for ATG. in organisms, the shape of the DNA (which is based in part on sequence) determines where transcription or translations begins, because the shape of the DNA molecule determines where those proteins can bind. This is not perfectly predictable. In real life, you'd need to have some kind of verified annotation to know where translation will begin. You'd have to be empirical. You can't just look at a DNA sequence and know for sure.

$\endgroup$

You must log in to answer this question.

Not the answer you're looking for? Browse other questions tagged .