2
$\begingroup$

I am trying to use bowtie2 to analyze my data in FASTA format, but it seems that this version can't read properly my data. My command line is as follows:

bowtie2 -x $REFERENCE -f $TARGET -S $TARGET.sam

The version 2 of bowtie complains with the following:

Warning: skipping read 'ORIGINAL: GACACTGTTCATGCTGGTGTCGCTGTCGGGCATTAT' because length (0) <= # seed mismatches (0)
Warning: skipping read 'ORIGINAL: GACACTGTTCATGCTGGTGTCGCTGTCGGGCATTAT' because it was < 2 characters long
Warning: skipping read 'ORIGINAL: GGCTATCTTGAAGCCAATGAGTTGTTAACTGGCAAG' because length (0) <= # seed mismatches (0)

Note that bowtie (version 1) is pleased by my FASTA! Here's a snippet and what bowtie says:

>ORIGINAL: GCTACGGAATAAAACCAGGAACAACAGACCCAGCAC
GCTACGGAATAAAACCAGGAACAACAGACCCAGCAC
>ORIGINAL: ATTAACAACAAAGGGTAAAAGGCATCATGGCTTCAG
ATTAACAACAAAGGGTAAAAGGCATCATGGCTTCAG
>ORIGINAL: GCAGAAAATGGGAGTGAAAATCTCCGATGAGCAGCT
AATGGGAGTGAAAATCTCCGATGAGCAGC

# reads processed: 471409
# reads with at least one reported alignment: 464583 (98.55%)
# reads that failed to align: 6826 (1.45%)

Now I'm at loss. Can anyone see what I'm doing wrong here? Can I trust anyway bowtie2 when it finishes and outputs how many sequences are aligned?

Thanks!

$\endgroup$
7
$\begingroup$

Since I apparently don't have enough reputation to comment, I'll post this as an answer and let someone move it.

Firstly, try to ensure that the order of the arguments are correct. You should be typing bowtie2 -f -x $TARGET -U $TARGET -S $TARGET.sam, since bowtie2 (as with many other programs) can be a bit picky about the argument order.

Secondly, it's usually advisable for the example input to include lines that are causing the problem (since it's apparently not complaining about the lines you posted, we can only assume that it's aligning them).

Thirdly, you'll typically only get those warnings if they're true. For example, if you were to grep -A 1 -w GACACTGTTCATGCTGGTGTCGCTGTCGGGCATTAT $target then my guess is that you'd find it to have no remaining sequence. Presumably these are the result of you trimming adapters or something like that, so just have your trimmer discard really short results (they won't align meaningfully anyway).

$\endgroup$
  • $\begingroup$ it makes a fine answer @DevonRyan $\endgroup$ – shigeta Sep 26 '14 at 23:48
  • $\begingroup$ Yeah even bowtie-1 doesn't take the argument bowtie -f $target.fa ..<other options> $\endgroup$ – WYSIWYG Sep 27 '14 at 5:55
  • $\begingroup$ Apparently, bowtie2 when reading headers will try to understand if the string is a DNA sequence: it does not ignore the content. However, it processes fine. Why it complains about headers, remains to me unknown. $\endgroup$ – senseiwa Dec 2 '14 at 13:33

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.