3
$\begingroup$

I have question about Gibson assembly. I have done it several times and it always worked okay for us, but now I want to assemble together a fragment which has sequence like this: 5'CTTTTTCTTCGTCGAAAAAGGCAATAAAAATTTTTATCACGTTTCTT3'.

Do you think a AA and TT repetitions will cause any problems? We usually used 30 bp of homology at both sides of sequence. Should I use more in this case? What are your experiences regarding this AT repetitive sequences?

thanks, Martin Kavšček

$\endgroup$
  • $\begingroup$ Yes this is a very low-complexity sequence. Can you paste your entire sequence? There might be some trick to work it out. $\endgroup$ – WYSIWYG Oct 16 '14 at 6:57

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Browse other questions tagged or ask your own question.