1
$\begingroup$

I am trying to align a sequence to the mouse genome. I know a priori that part of my sequence should align to chromosome 9, but not all of it.

I gathered that EMBOSS' matcher and supermatcher would be adequate tools to do this locally on my machine - with supermatcher being (a lot!) faster and matcher being (allegedly) more accurate. Strangely enough, the two functions give me very similar fits (quality-wise) which are however at non-identical but very close positions.

  • How can I explain this?
  • What are the odds that an ~800-bp sequence has multiple equally good fits right next to each other (how can I test if I hit a repeat-heavy area?)?
  • Why do match and supermatch not give me both fits then?

My current alignments:

#=======================================
#
# Aligned_sequences: 2
# 1: 
# 2: CM001002.2
# Matrix: EDNAFULL
# Gap_penalty: 16.0
# Extend_penalty: 4.0
#
# Length: 357
# Identity:     322/357 (90.2%)
# Similarity:   322/357 (90.2%)
# Gaps:           2/357 ( 0.6%)
# Score: 1458.0
# 
#
#=======================================

                   1 AAAAACGTGAAAAATGAGAAATGCACACTGTAGGACCTGAAATATGGCAA     50
                     ||||.|..|.||||||||||||.||||||.||||||.|||||.|||||.|
CM001002.2    35305253 AAAATCACGGAAAATGAGAAATACACACTTTAGGACGTGAAAAATGGCGA 35305302

                  51 GGAAAACTGAAAAAGGTGGAAAATTTAGAAATGTCCACTATAGGACGTGG    100
                     ||||||||||||||||||||||||||||||||||||.||.||||||.|||
CM001002.2    35305303 GGAAAACTGAAAAAGGTGGAAAATTTAGAAATGTCCTCTGTAGGACATGG 35305352

                 101 AATATGGCAAGAAAAATGAAAATCATTGAAAATGAGAAACATACAGTTGA    150
                     |||||||||||||||.||||||||||.|||||||||||||||.||.||||
CM001002.2    35305353 AATATGGCAAGAAAACTGAAAATCATGGAAAATGAGAAACATCCACTTGA 35305402

                 151 CGACTTGAAAAATGATGAAATCACTGAAAAACGTGAAAAATGAGAAATGC    200
                     .||||||||||||||.|||||||.|.||||||||||||||||||||||||
CM001002.2    35305403 TGACTTGAAAAATGACGAAATCATTAAAAAACGTGAAAAATGAGAAATGC 35305452

                 201 ACCCTGTAAGACCTGGAATATGTCGAGAAAACTGAAAATCACGGAAAATG    250
                     .|.|||.|.|||||||||||||..||||||||||||||||||||||||||
CM001002.2    35305453 CCACTGAAGGACCTGGAATATGGGGAGAAAACTGAAAATCACGGAAAATG 35305502

                 251 AGAAATACACACTTTAGGACGTGAAATATGGCGAGGAAAACTGAAAAAGG    300
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
CM001002.2    35305503 AGAAATACACACTTTAGGACGTGAAATATGGCGAGGAAAACTGAAAAAGG 35305552

                 301 TGGAAAATTTAGAAATGTCCACTGTAGGACATGGAATAT--GGCAAGAAA    348
                     |||||.||||||||||||||||||||||||.||||||||  |.|.|||||
CM001002.2    35305553 TGGAATATTTAGAAATGTCCACTGTAGGACGTGGAATATAAGTCCAGAAA 35305602

                 349 ACTGAAA    355
                     .||.|.|
CM001002.2    35305603 CCTAAGA 35305609

and:

#=======================================
#
# Aligned_sequences: 2
# 1: 
# 2: CM001002.2
# Matrix: EDNAFULL
# Gap_penalty: 16
# Extend_penalty: 4
#
# Length: 417
# Identity:     377/417 (90.4%)
# Similarity:   377/417 (90.4%)
# Gaps:           2/417 ( 0.5%)
# Score: 1713
# 
#
#=======================================

          180       190       200       210       220    
       TGAAAAACGTGAAAAATGAGAAATGCACCCTGTAAGACCTGGAATATGTC
       ::  : ::   : :: :  ::  ::::: ::: : ::::::::::    :
CM0010 TGTCACACACTATAATTTTGAGGTGCACACTGAAGGACCTGGAATTATGC
       35305200  35305210  35305220  35305230  35305240  

          230       240       250       260       270    
       GAGAAAACTGAAAATCACGGAAAATGAGAAATACACACTTTAGGACGTGA
       ::::::::::::::::::::::::::::::::::::::::::::::::::
CM0010 GAGAAAACTGAAAATCACGGAAAATGAGAAATACACACTTTAGGACGTGA
       35305250  35305260  35305270  35305280  35305290  

          280       290       300       310       320    
       AATATGGCGAGGAAAACTGAAAAAGGTGGAAAATTTAGAAATGTCCACTG
       :: ::::::::::::::::::::::::::::::::::::::::::: :::
CM0010 AAAATGGCGAGGAAAACTGAAAAAGGTGGAAAATTTAGAAATGTCCTCTG
       35305300  35305310  35305320  35305330  35305340  

          330       340       350       360       370    
       TAGGACATGGAATATGGCAAGAAAACTGAAAATCATGGAAAATGAGAAAC
       ::::::::::::::::::::::::::::::::::::::::::::::::::
CM0010 TAGGACATGGAATATGGCAAGAAAACTGAAAATCATGGAAAATGAGAAAC
       35305350  35305360  35305370  35305380  35305390  

          380       390       400       410       420    
       ATCCACTTGACGACGTGAAAAATGACGAAATCACTGAAAAACGTGAAAAA
       :::::::::: ::: :::::::::::::::::: : ::::::::::::::
CM0010 ATCCACTTGATGACTTGAAAAATGACGAAATCATTAAAAAACGTGAAAAA
       35305400  35305410  35305420  35305430  35305440  

          430       440       450       460       470    
       TGAGAAATGCACACTGTAGGACCTGGAATATGTCGAGAAAACTGAAAATC
       :::::::::: ::::: :::::::::::::::  ::::::::::::::::
CM0010 TGAGAAATGCCCACTGAAGGACCTGGAATATGGGGAGAAAACTGAAAATC
       35305450  35305460  35305470  35305480  35305490  

          480       490       500       510       520    
       ACGGAAAATGAGAAATACACACTTTAGGACGTGAAATATGGCGAGGAAAA
       ::::::::::::::::::::::::::::::::::::::::::::::::::
CM0010 ACGGAAAATGAGAAATACACACTTTAGGACGTGAAATATGGCGAGGAAAA
       35305500  35305510  35305520  35305530  35305540  

          530       540       550       560       570    
       CTGAAAAAGTTGGAAAATTTAGAAATGTCCATTGTAGGACATGGAATAT-
       ::::::::: ::::: ::::::::::::::: :::::::: :::::::: 
CM0010 CTGAAAAAGGTGGAATATTTAGAAATGTCCACTGTAGGACGTGGAATATA
       35305550  35305560  35305570  35305580  35305590  

            580         
       -GGCAAGAAAACTGAAA
        : : ::::: :: : :
CM0010 AGTCCAGAAACCTAAGA
       35305600  
$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Browse other questions tagged or ask your own question.