I am reading an article about Genetic Polymorphism and there are lines in the article about genetic polymophism that I don't quite understand like.
Can someone explain genetic polymorphism and morphic distribution in layman terms.
Thanks
$\begingroup$
$\endgroup$
2
-
2$\begingroup$ Can you link the article. $\endgroup$– Chris ♦Mar 4, 2015 at 21:48
-
1$\begingroup$ Read the wiki article on polymorphism (genetic section) and then ask if you don't understand something specific en.m.wikipedia.org/wiki/Polymorphism_%28biology%29 $\endgroup$– rg255Mar 5, 2015 at 8:11
Add a comment
|
1 Answer
$\begingroup$
$\endgroup$
2
Polymorphic sites
Consider the following sequence of DNA
ATTTGC
Now consider that in a population of 5 haploid individuals (in reality populations are larger of course) you have the 5 following sequences
ATTTGCATTTGCATCTGTATTTGCATCTGC
Looking at those sequences you can identify two sites (site 3 and site 6) for which the nucleotides vary throughout the population. For example, at site 3, 3 individuals have a T while 2 individuals have a C. Sites 3 and site 6 are said to be polymorphic sites (a.k.a. segregating sites).
Statistics of genetic variance related to polymorphic sites
Note that there are all sorts of ways to describe the genetic diversity in this population. You could calculate the total number of segregating sites or the average number of pairwise difference between any two sequence. Or the average expected (and not observed) heterozygosity (which is sometime refer to as genetic diversity). One could calculate the frequency distribution of the number of individuals carrying a given variant (called the site-frequency spectrum).
Other polymorphism
Note that I emphasized on polymorphic sites for the moment but there are a whole bunch of different reasons that two genomes may differ. Two sequences may differ in their length as well (insertions and deletions of nucleotides). Genomes may differ in the number of copy of a given sequence (copy number variation). Genomes may differ in the number of copy of very very long sequences or in the order of those sequences (synteny). Genomes may differ in their number of chromosomes or in their ploidy level.
About the citation
In this area,there are six different chemotypes that are the expression of a genetically controlled polymorphism inT.vulgaris(24)
It is hard to say anything without the link to the article.
There are six different chemotypes (found in the population). Not all individuals have all chemotypes (eventually each individual has one or two chemotypes). Having one or another chemotype depend on your DNA sequence.
Assuming that the difference is due to polymorphic sites (which is impossible to say for sure without reading the paper), there is therefore one (or several) polymorphic sites that explain the variance in chemotypes in the population.
-
$\begingroup$ Did you mean nucleotide instead of amino acid? $\endgroup$ Sep 18, 2015 at 17:34
-
$\begingroup$ Google NINJA!!! pnas.org/content/110/8/2893.full $\endgroup$– AMRSep 19, 2015 at 4:59