0
$\begingroup$

I am trying to get a good pair (or better yet, library of pairs) of primers that give me one band in WT mice (C57BL/6). Do you know where I could find such a thing?

Alternatively, I thought of just designing a few sets of primers myself for highly-conserved regions. But that's quite a bit of guessing work (what regions, what pairs from what eprimer3 will calculate for me etc.).

So:

  • Do you know where such a database could be found?
  • If not, could you help me get started with creating it myself? What specific regions would in your opinion be particularly good for this purpose?
|improve this question
$\endgroup$
  • $\begingroup$ One band of what? Just a random genome segment, or are you looking to amplify something more specific? $\endgroup$ – Wolgast Apr 4 '15 at 17:50
  • $\begingroup$ Something I can rely on is there in all WT and most if not all transgenes. $\endgroup$ – TheChymera Apr 4 '15 at 17:51
  • $\begingroup$ This is impossible to be done. You can make primers to distinguish between mice which are mutated and wildtype mice (at least for one gene or locus), but you cannot do this for the whole genome. Here you could sequence your mouse and compare it to the reference sequence. What is your gene of interest? $\endgroup$ – Chris♦ Apr 4 '15 at 17:57
  • $\begingroup$ I just want a pair (or library of pairs) of primers that will ~always work. As a positive control. $\endgroup$ – TheChymera Apr 4 '15 at 17:58
  • 2
    $\begingroup$ then use actin, or tubulin, or GAPDH, or one of a thousand other genes. $\endgroup$ – MattDMo Apr 6 '15 at 0:57
0
$\begingroup$

I have settled for two GAPDH primers with a short amplicon (~50bp):

>gapdh_rv3 <unknown description>
GAGACCTGAATGCTGCTTCC 

>gapdh_fw3 <unknown description>
CTCCATTTCCCCTGTTCTCC

They provide consistent and good controls, as seen here (lower bands):

enter image description here

|improve this answer
$\endgroup$
  • $\begingroup$ how do you know those aren't primer-dimers? you should aim to amplify >= 100bp $\endgroup$ – dblyons Apr 14 '17 at 19:29
  • $\begingroup$ Because my primers aren't complementary, and the band only appears if there is sufficient mouse DNA in the sample $\endgroup$ – TheChymera Apr 14 '17 at 23:16

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.