3
$\begingroup$

I'm wondering what would we need to do to create a living dinosaur using DNA technology? If it is not possible with current technology, will it ever be feasible?

In the movie Jurassic Park, scientists extract dinosaur DNA from a mosquito which was preserved in amber, and which has sucked blood from a dinosaur. The DNA is incomplete, so the scientists splice it with frog DNA. The DNA is then inserted into a crocodile ova and an embryo is created, and so on.

The Jurrassic park method is dubious. Although dinosaur DNA has been found and isolated, it was too damaged to restore it to its original form using current technology. It's not clear that splicing with frog DNA would work. Let's for the moment forget about how you would get the dinosaur embryo to develop and the eggs to incubate and hatch. I want to know how would we fully sequence the genome of some dinosaur?

$\endgroup$
3
  • $\begingroup$ Check this TED talk from Jack Horner: Building a dinosaur from a chicken. Quite interesting. $\endgroup$ Apr 24, 2015 at 7:55
  • $\begingroup$ Jurassic Park approach is more or less correct. We can gather many DNA fragments and reconstruct entire chain by overlapping. Modern beings also can be used. $\endgroup$
    – Dims
    Apr 24, 2015 at 8:27
  • 3
    $\begingroup$ If birds evolved from dinosaurs, birds are a subset of dinosaurs. This makes birds dinosaurs. Technically we don't need DNA technology to make birds, Tyson Foods does it on industrial scale every day so you can get your dinosaur mcnuggets. $\endgroup$
    – user137
    Apr 24, 2015 at 22:34

2 Answers 2

4
$\begingroup$

It is widely accepted that birds are in fact dinosaurs. Cladistically speaking, no DNA technology is required to create a living dinosaur, as they already exist.

Assuming you want to do the same to a non-avian dinosaur (a paraphyletic group), however, a better idea would be to ask on World Building SE, as there have been little to no scientific research on the topic, and speculative answers are generally considered off topic here.

$\endgroup$
0
$\begingroup$

Comparing back to related DNA is how it has been done in the past with the woolly mammoth. So it might be a mater of extracting enough and finding close enough relatives to do this. But from what I have read, the DNA is so heavily fragmented that is is relatively impossible to map even to close relatives. You can understand this as the more heavily fragmented the DNA the smaller the pieces. So if you have a strand like this:

ACTGATCGTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTACTACTAGCT

It is long and may map to only one or two locations on a relative's genome. But if you have heavily fragmented strands that are much shorter like this:

AGTC

You can imagine that would map to millions of different locations. So putting these in order would essentially be impossible.

We have to also put these things on a timeline to really understand the difficulty, Woolly Mammoths lived 500,000 years ago, dinosaurs were like 60 million years ago.

$\endgroup$
4
  • $\begingroup$ So will it ever be possible to create a dinosaur? $\endgroup$
    – math_lover
    Apr 24, 2015 at 19:19
  • $\begingroup$ I hate saying things are impossible in biology, but this seems pretty close to impossible. $\endgroup$ Apr 24, 2015 at 20:43
  • $\begingroup$ Unless someday we fully understand how to 'program' from scratch designer organisms and create one from scratch. Obviously quite the challenge. $\endgroup$ Apr 24, 2015 at 20:44
  • $\begingroup$ Woolly mammoths were around a lot more recently than that. According to Wikipedia, they diverged from the steppe mammoth around 400,000 years ago and didn't start going extinct until around 40,000 years ago. Isolated populations of woolly mammoths are believed to have existed 4,000-7,000 years ago. $\endgroup$
    – Gaurav
    Jun 4, 2015 at 1:34

You must log in to answer this question.

Not the answer you're looking for? Browse other questions tagged .