2
$\begingroup$

I notice on dbSNP rs6352 has an ancestral allele of G - http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=rs6352

The hapmap in humans for this allele is very rare, the homozygous version practically not existing at all http://hapmap.ncbi.nlm.nih.gov/cgi-perl/snp_details_phase3?name=rs6352&source=hapmap3r3_B36&tmpl=snp_details_phase3

My understanding has been that the ancestral allele refers to the common gene that an ancestor in all humans once shared. Now, I thought the ancestral allele was usually the most frequent in a population, but I can see this was most likely a wrong assumption.

Was it a wrong assumption, or was this example above just a rare exception? Is deviation from ancestral alleles nearly worthless as a metric to investigate possible mutated alleles that may be leading to disease? I realize the proper answer may be too long, but just a brief summary would be appreciated.

Many thanks.

$\endgroup$
1
$\begingroup$

It is kind of confusing. Here's the sequence, from the ncbi link

GGACATTTAAMGAGGTACGTG

So M is "A or C"

Its a missense mutation, the amino acid called for is either an N or a K.

GGACATTTAAAGAGGTACGTG = K amino acid

GGACATTTAACGAGGTACGTG = N amino acid

GGACATTTAAGGAGGTACGTG = K amino acid

GGACATTTAATGAGGTACGTG = N amino acid

When you blastx it, the top hits are all the K allele, across a few species.

When you blast the DNA, the non-human hits in nr all have a G, not an A or C. So I guess that's why they are calling that the ancestral allele. The human hits to nr all have A, so the K amino acid is conserved.

$\endgroup$
0
$\begingroup$

Typically, the ancestral allele is inferred from the allele chimpanzees as our closest relative (and possibly some primates) have. While for most sites humans and chimps have the same allele, there are many cases where the ancestral allele is even completely absent from humans, and where all humans have a different allele from chimpanzees, which we call a substitution.

A substitution in a critical part of a protein can indeed indicate some biological significance, a classical example is the FOXP2 gene, that is related to speech development. In most cases however, substitutions are merely due to genetic drift occurring over millions of years.

$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.