0
$\begingroup$

My understanding is that paired end reads from the Illumina HiSeq/MiSeq platforms looks something like this:

R1:
    AAAAAACCCCCC
R2:
    GGGGGGTTTTTT

Where the reads found in R2 are the reverse complement of those found in R1. This does not appear to be the case however, for my sequencing data. If it helps I have a read pair from one of my MiSeq runs below.

R1:
@M01814:86:000000000-A6MU9:1:1101:15397:1339 1:N:0:2
TACTCGCACCTATCCGGCACAGCAACACCATCTGGGGCTGAATCGCAATAGCATCTCTCACTTCCTCCATATCAGATTGCTCAAGGCAAGCACTACGCTGCAGTGCCCTCCACTCCCAATTCCCTGATGCTGGTCGTAACTTGCCACACCA
+
>>AA?BBBBBFFGGG2EEEGFBGHHHGA2FGHBGHF2EE?GHGHHFFEEHDGHEFGF5FEEFBGHGBCB5FHHH5F553@434FF31G11??233B1/1/?333B?3FB?/B24B2/2B2?44?3?23333B223<>@0CB22@2@F0/?/

R2:
@M01814:86:000000000-A6MU9:1:1101:15397:1339 2:N:0:2
TAAGGGGCCTAGAACAGGCACCATACATTCAATTGGCTGTGGCAAGTAACAACCAGCATCAGGGAATGTGGAGTGGAGGGCACTGCAGCGAATTGCTTGCCTTGAACAATCTTATATGGGGGAAGTAGACGAACCAATGTGGAGTCAGCCC
+
>AA>>>ADDAFFGGGGG4FGGGFHFHFHHHFHHHB3B32EFBGGE25FGHHHHACEGG533BAGFFF355331BG1@1>EF1E23F333/>//134B43?F34B3334B334444?443B?/<C/23333////<0/<11111/?01?G0?

For reference, this is the reverse complement of R2:

GGGCTGACTCCACATTGGTTCGTCTACTTCCCCCATATAAGATTGTTCAAGGCAAGCAATTCGCTGCAGTGCCCTCCACTCCACATTCCCTGATGCTGGTTGTTACTTGCCACAGCCAATTGAATGTATGGTGCCTGTTCTAGGCCCCTTA

This is the alignment (with BLAST; alignment shown only for the HSP):

                                                           60                                                                                      148
                                                           |                                                                                       |
TACTCGCACCTATCCGGCACAGCAACACCATCTGGGGCTGAATCGCAATAGCATCTCTCACTTCCTCCATATCAGATTGCTCAAGGCAAGCACTACGCTGCAGTGCCCTCCACTCCCAATTCCCTGATGCTGGTCGTAACTTGCCACACCA
                                                           |||||| |||||| |||||| |||||||||||| | |||||||||||||||||||||  |||||||||||||||| || ||||||||||
                                  GGGCTGACTCCACATTGGTTCGTCTACTTCCCCCATATAAGATTGTTCAAGGCAAGCAATTCGCTGCAGTGCCCTCCACTCCACATTCCCTGATGCTGGTTGTTACTTGCCACAGCCAATTGAATGTATGGTGCCTGTTCTAGGCCCCTTA
                                                           |                                                                                       |
                                                           126                                                                                     38
$\endgroup$
  • $\begingroup$ What was the size of the library and what is the read length? $\endgroup$ – WYSIWYG Sep 9 '15 at 17:35
  • $\begingroup$ MiSeq chemistry is 150 cycles and fragment size is exactly 150bp. $\endgroup$ – The Nightman Sep 9 '15 at 18:09
  • $\begingroup$ Are you sure the fragment size is exactly 150bp? Usually you have a distribution of fragment size. $\endgroup$ – WYSIWYG Sep 10 '15 at 5:19
  • $\begingroup$ How many such reads are there; did you remove the adapter sequences? $\endgroup$ – WYSIWYG Sep 10 '15 at 14:18
  • $\begingroup$ I am sure of the fragment size and the adapter sequences are removed, but thanks for blasting this, that is more of an overlap that I have been able to force. Maybe I just need to allow for many more mismatches than previously thought. $\endgroup$ – The Nightman Sep 10 '15 at 15:00
4
$\begingroup$

Where the reads found in R2 are the reverse complement of those found in R1.

This statement seems incorrect.

Paired-end reads comes from opposite ends of a fragment (you could learn the reason it happens from Illumina's video). If insert size is 150bp, read length usually is ~60bp as quality score after 60th bp is unacceptably low. In this case, R1 length is ~60bp, and it is 5'3', R2 length is ~60bp, and it is 3'5'. When a number of reads are enough to cover the gap, they form a contig.

Here's an illustration from Illumina's website: From Illumina's website

$\endgroup$
0
$\begingroup$

There is a little wobble in the lengths of your fragments, that's why the reads don't exactly overlap. Is there a reason that you are spending the time and money to do the second read when the first read gives you almost the exact same sequence information?

$\endgroup$
  • $\begingroup$ There is no wobble in these fragment lengths (this is not just fragmented DNA). And yes paired end reads are likely to be necessary. $\endgroup$ – The Nightman Sep 9 '15 at 21:29

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.