What do Illumina HiSeq/MiSeq paired end reads look like?

Question

My understanding is that paired end reads from the Illumina HiSeq/MiSeq platforms looks something like this:

R1:
    AAAAAACCCCCC
R2:
    GGGGGGTTTTTT

Where the reads found in R2 are the reverse complement of those found in R1. This does not appear to be the case however, for my sequencing data. If it helps I have a read pair from one of my MiSeq runs below.

R1:
@M01814:86:000000000-A6MU9:1:1101:15397:1339 1:N:0:2
TACTCGCACCTATCCGGCACAGCAACACCATCTGGGGCTGAATCGCAATAGCATCTCTCACTTCCTCCATATCAGATTGCTCAAGGCAAGCACTACGCTGCAGTGCCCTCCACTCCCAATTCCCTGATGCTGGTCGTAACTTGCCACACCA
+
>>AA?BBBBBFFGGG2EEEGFBGHHHGA2FGHBGHF2EE?GHGHHFFEEHDGHEFGF5FEEFBGHGBCB5FHHH5F553@434FF31G11??233B1/1/?333B?3FB?/B24B2/2B2?44?3?23333B223<>@0CB22@2@F0/?/

R2:
@M01814:86:000000000-A6MU9:1:1101:15397:1339 2:N:0:2
TAAGGGGCCTAGAACAGGCACCATACATTCAATTGGCTGTGGCAAGTAACAACCAGCATCAGGGAATGTGGAGTGGAGGGCACTGCAGCGAATTGCTTGCCTTGAACAATCTTATATGGGGGAAGTAGACGAACCAATGTGGAGTCAGCCC
+
>AA>>>ADDAFFGGGGG4FGGGFHFHFHHHFHHHB3B32EFBGGE25FGHHHHACEGG533BAGFFF355331BG1@1>EF1E23F333/>//134B43?F34B3334B334444?443B?/<C/23333////<0/<11111/?01?G0?

For reference, this is the reverse complement of R2:

GGGCTGACTCCACATTGGTTCGTCTACTTCCCCCATATAAGATTGTTCAAGGCAAGCAATTCGCTGCAGTGCCCTCCACTCCACATTCCCTGATGCTGGTTGTTACTTGCCACAGCCAATTGAATGTATGGTGCCTGTTCTAGGCCCCTTA

This is the alignment (with BLAST; alignment shown only for the HSP):

                                                           60                                                                                      148
                                                           |                                                                                       |
TACTCGCACCTATCCGGCACAGCAACACCATCTGGGGCTGAATCGCAATAGCATCTCTCACTTCCTCCATATCAGATTGCTCAAGGCAAGCACTACGCTGCAGTGCCCTCCACTCCCAATTCCCTGATGCTGGTCGTAACTTGCCACACCA
                                                           |||||| |||||| |||||| |||||||||||| | |||||||||||||||||||||  |||||||||||||||| || ||||||||||
                                  GGGCTGACTCCACATTGGTTCGTCTACTTCCCCCATATAAGATTGTTCAAGGCAAGCAATTCGCTGCAGTGCCCTCCACTCCACATTCCCTGATGCTGGTTGTTACTTGCCACAGCCAATTGAATGTATGGTGCCTGTTCTAGGCCCCTTA
                                                           |                                                                                       |
                                                           126                                                                                     38

Answer 1

Where the reads found in R2 are the reverse complement of those found in R1.

This statement seems incorrect.

Paired-end reads comes from opposite ends of a fragment (you could learn the reason it happens from Illumina's video). If insert size is 150bp, read length usually is ~60bp as quality score after 60th bp is unacceptably low. In this case, R1 length is ~60bp, and it is 5'3', R2 length is ~60bp, and it is 3'5'. When a number of reads are enough to cover the gap, they form a contig.

Here's an illustration from Illumina's website:

Answer 2

There is a little wobble in the lengths of your fragments, that's why the reads don't exactly overlap. Is there a reason that you are spending the time and money to do the second read when the first read gives you almost the exact same sequence information?