1
$\begingroup$

Suppose, we have a double stranded DNA like

5' AGCTAGGAGAGACCAGGTTCC 3'

3' TCGATCCTCTCTGGTCCAAGG 5'

Where would the methylated cytosine be? Is there any randomness?

$\endgroup$
  • $\begingroup$ It is usually at CpG however there are non-CpG methylations too. It is not easy to predict. You can however use machine learning by training from existing experimental data. $\endgroup$ – WYSIWYG Oct 12 '15 at 16:59

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Browse other questions tagged or ask your own question.