2
$\begingroup$

I am currently working on a project where I need to trim the adapters off of some single end read RNA-Seq data, and I want to know which sequences to cleave. Illumina TruSeq adapters were used. I have tried following Tuft's explanation and make sense of Illumina's video, but I am left with several unresolved questions.

The TruSeq Universal adapter, seems to be what binds to the flow cell and is

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

The TruSeq Adapter Index N is

 GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-NNNNNN-ATCTCGTATGCCGTCTTCTGCTTG

My impression of how the cDNA fragment attached to the adapters is :

(flow cell)
||
||
||                                             (Index Adapter)                                               (Universal Adapter)
||    3'                                                                5'                          3'                                                        5'  
||    GTTCGTCTTCTGCCGTATGCTCTA-NNNNNN-CACTGACCTCAAGTCTGCACACGAGAAGGCTAGA                           TCTAGCCTTCTCGCAGCACATCCCTTTCTCACATCTAGAGCCACCAGCGGCATAGTAA
||                                                         ||||||||||||||                           ||||||||||||||                                                              <----- Must get denatured!
||        5'   AATGATCGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT--(5' MY DNA FRAGMENT 3')--AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC‐NNNNNN‐ATCTCGTATGCCGTCTTCTGCTTG
||-------------TTACTAGCCGCTGGTGGCT                                     3'                           5'                                                                3'  
||    
||             ^(Flow cell oligo)              ^(Universal Adapter)                                            ^(Index Adapter)
||  
||                                     TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA                           TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGTG
||    
||                                             ^(Read 1 Primer)                                                ^(Read 2 Primer)
||
||    
||                                                                                                                                           TAGAGCATACGGCAGAAGACGAAC----------||
||    
||                                                                                                                                               ^(Flow cell oligo)
||

Here are my questions :

  1. Is this image correct in the single stranded case?

  2. Do I have the correct primer binding site (used for the actual sequencing)?

  3. Do I have the correct oligo for paired end reads, i.e. TAGAGCATACGGCAGAAGACGAAC---------?

  4. Do I have the correct primer (and it's site) for the index read?

Per Illumina, I guess I need to include this : "Oligonucleotide sequences © 2007-2013 Illumina, Inc. All rights reserved. Derivative works created by Illumina customers are authorized for use with Illumina instruments and products only. All other uses are strictly prohibited."

$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Browse other questions tagged or ask your own question.