7
$\begingroup$

I have downloaded human chromosome's data from UCSC FTP. Some part is in small alphabets and some is in large alphabets. Does it show the coding and non-coding region?

Here is an example from the file I just downloaded:

gagaatcccttgaacccgggaggcggagcttgctgtgagccgagatcgca
ccactgcactccagcctgggtgacagagccagactccgtctcaaaataaa
taaataaataaataaataaaAAAGAAAAAGGTTAATACAACATTAAAGAA
CAAGAATTAATATAGCtttttttttttttttttttttttgagacctagtc
tcactctgttgcccaggctggagggcagtggcatgatctcagctcactgc
aacctccgcctcccgggttcaggcgattctcctgcctcagcctcccgaat
aggtgggattacaggcgtgcaccaccatgcctactttttgtatttttagt
agagacggggtttcactatgttggccaggctggtgtcgaactcttgacct
caagtgatctgcctgccttggcctcccaaagtgctgggatgacaggtgtg
agccactgcacctggccTAATATAGCTTTAATAGAAAAGGAGCTAATACA
AGCTTAGAATAATAAACTTTATGCAGACTTACTGAAACAAACAGTCAATG
CAACCTTAACCAAACAGGAATTGATAACAGTTTAATAAAAAAGCTAATAC
CACTTGAATAGAATATATCTTACTACAACCTTCATAAGAAAAACAACTAA
TAcactttgggagaccgaggcaggcagatcacgaggtcaggagatcgaga
ccatggtgaaaccccgcctctactaaaaatacaaaaaaattagcctggca

  • Second strange thing is to see it beginning with sequence like NNNN. Like here it is:

    >chrX NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN ctaaccctaaccctaaccctaaccctaaccctaaccctCTGaaagtggac ctatcagcaggatgtgggtgggagcagattagagaataaaagcagactgc

So the question is two fold:

  1. What is the difference between upper and lower case in nucleotide fasta sequences?
  2. What are the repeating N characters denoting?
Improve this question
$\endgroup$
  • 3
    $\begingroup$ On the web page that you linked to there is a file named README.txt. I suggest that you read it. $\endgroup$ – mdperry Apr 17 '16 at 5:49
  • $\begingroup$ @mdperry I did. But it has nothing related to these N's and lower/upper case $\endgroup$ – Failed Scientist Apr 17 '16 at 6:43
  • 2
    $\begingroup$ "Repeats from RepeatMasker and Tandem Repeats Finder (with period of 12 or less) are shown in lower case; non-repeating sequence is shown in upper case." This is the relevant passage in the README.txt file. As described in one of the answers, in the IUPAC symbol table for referring to nucleotide bases, where the most common ones are ACGT and U (typically in RNA), the 'N' symbol is used to either represent a base in a sequence motif pattern where any of the 4 may be found, OR in a sequencing run, a base position where the actual base could not be unambiguously determined. $\endgroup$ – mdperry Apr 17 '16 at 15:18
5
$\begingroup$

The FTP download files are documented on the UCSC site (from which they also may be downloaded from a web browser). The page for the human genome is http://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/. I don't know which files you downloaded, but I quote three of the descriptions:

hg38.2bit - contains the complete human/hg38 genome sequence in the 2bit file format. Repeats from RepeatMasker and Tandem Repeats Finder (with period of 12 or less) are shown in lower case; non-repeating sequence is shown in upper case.

hg38.fa.gz - "Soft-masked" assembly sequence in one file. Repeats from RepeatMasker and Tandem Repeats Finder (with period of 12 or less) are shown in lower case; non-repeating sequence is shown in upper case.

hg38.fa.masked.gz - "Hard-masked" assembly sequence in one file. Repeats are masked by capital Ns; non-repeating sequence is shown in upper case.

It would appear that the number of Ns corresponds to the number (perhaps an estimate) of bases the identity of which are not known. This is suggested by the following on the general downloads FAQ page at https://genome.ucsc.edu/FAQ/FAQdownloads.html.

N characters at beginning of human chr22

Question: "When I download human chr22 from your web site, the unzipped file contains only N's."

Response: There is a large block of N's at the beginning and end of chr22. Search for an A to bypass the initial group of N's.

Difference between UCSC and GenBank files

If you download the human chromosome data from GenBank you will not find the lower-case characters (i.e. they are not a standard feature). The reason they are in the UCSC files is because these files are the ones used within their Genome Browser, which displays these repeats, as illustrated below.

Repeats in UCSC Genome Browser display

Improve this answer
$\endgroup$
7
$\begingroup$

Lowercase letters indicate repeat-masked regions. N's represent gaps.

See: https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/S4Sx8UdJAwM/tLTpVVzdhFMJ

Improve this answer
$\endgroup$
  • 1
    $\begingroup$ How is the number of N's determined ? $\endgroup$ – bli Apr 17 '16 at 5:31
  • 2
    $\begingroup$ In my experience, a run of N's, like 30 or 50, or 100, used to indicate a gap between two mapped contigs, but nowadays, with NGS sequencers I think they usually represent a base that could not be determined unambiguously, and thus for the purposes of length measurement we know the Number of bases in the fragment, but not the actual sequence of every base. $\endgroup$ – mdperry Apr 17 '16 at 15:41
4
$\begingroup$

Sequence in caps are usually regions of interest, such as exons. N in the DNA alphabet refers to "unknown nucleotide" It can refer to any of A/T/C/G when the actual underlying base is unknown.

Improve this answer
$\endgroup$
3
$\begingroup$

The IUPAC Nomenclature symbol table for RNA and DNA nucleotide sequences (via Wikipedia)

The IUPAC Nomenclature symbol table for RNA and DNA nucleotide sequences (via Wikipedia)

Improve this answer
$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.