0
$\begingroup$

Please could someone explain these lines to me in a simple way

These sequences were then arranged based on some overlapping regions present in them. This required generation of overlapping fragments for sequencing. These sequences were subsequently annotated and assigned to each chromosome

What do "arranging" and "assigning" mean in this context?

Source: NCERT class 12 (This text in in reference to the method developed by Frederick Sanger)

Improve this question
$\endgroup$
1
  • $\begingroup$ I edited the post to improve its format. Feel free to roll back if you don't like it. Would be great if you could link to the source. $\endgroup$
    – Remi.b
    May 8, 2016 at 15:38

1 Answer 1

Reset to default
1
$\begingroup$

Word "arranged" means simply alignment of sequence based on overlapping regions in two sequences. For example:

Seq1: AGTGTCCGTCGTAAGTCA

Seq2:GTCGTAAGTCATCGAGATACC

leading to:

Seq12: AGTGTCCGTCGTAAGTCATCGAGATACC

Maybe he used the word "arrange" as overlapping determines the direction of resultant sequence (for which word alignment is sufficient)

Assignment: Is simply dividing the genome's sequence down as per chromosomes of the species. Like for example, if it's human genome sequence and first chromosome is 2,50,000bp long (just assumption - I don't remember exact figure), then first 2,50,000 nucleotides in the sequence will be "assigned" to chromosome 1. From 2,50,001 onwards to chromosome 2 and so on..

Improve this answer
$\endgroup$
1
  • $\begingroup$ @Felix_17 Pleasure! :) $\endgroup$
    – Failed Scientist
    May 9, 2016 at 13:43

You must log in to answer this question.

Not the answer you're looking for? Browse other questions tagged .