1
$\begingroup$

From what I know, multiple strands of DNA make up a gene, so how can for each gene there can only be one RNA corresponding to it and vice versa? Is my knowledge incorrect?

$\endgroup$
  • 1
    $\begingroup$ how are you defining "gene"? $\endgroup$ – Vance L Albaugh Aug 15 '16 at 1:08
  • $\begingroup$ By multiple strands do you mean two strands of DNA ? By what I have understood from your question you seem to ask how can a single RNA be formed when a gene is a fragment of a DNA (ds DNA) . Isn't it? $\endgroup$ – Tyto alba Aug 15 '16 at 11:41
  • $\begingroup$ No, I mean doesn't a combination of DNA molecules form a gene? $\endgroup$ – Bob Aug 15 '16 at 15:38
  • $\begingroup$ No. Each gene is on a single molecule of DNA. $\endgroup$ – terdon Aug 16 '16 at 13:30
2
$\begingroup$

Very few things are that clear cut in biology. There are three main things to consider here.

1. Gene to RNA

Most eukaryotic genes are spliced. This is basically a process by which a single gene can be transcribed to multiple, different, mRNAs each of which will then be translated to a different protein.

Therefore, there is usually (some genes aren't spliced) not a one-to-one correspondance between a gene and the mRNAs it can produce.

2. RNA to Gene

The next issue is that some genes exist in multiple, similar copies in the genome. For such genes, it is not always possible to know which of the duplicates was actually read to produce a given mRNA.

There is, therefore, not always a direct one-to-one correspondance between an mRNA and the gene it was transcribed from. This, however, is far less common than the splicing issue mentioned above and can, in most cases, be ignored.

3. Each gene is only on a single strand

Each gene is only on a single strand of DNA. Yes, DNA is double stranded, but each gene resides on only one of the two strands (the other strand will be the reverse complement of the gene).


Despite the points made above, it is actually usually possible to map an mRNA molecule to the gene that produced it. In the case of duplicate genes you'll just get multiple hits. The programs that exist to do this sort of analysis can mostly deal with splicing. So, for example, if you have the sequence of the human chromosome 21 and the mRNA sequence of the ERG gene, you can do (on a *nix system with exonerate installed):

exonerate -m coding2genome -t chr21.fasta -q dscam.fasta > out

Which will produce:

Command line: [exonerate -m est2genome -n 1 -t chr21.fasta -q erg.fasta]
Hostname: [oregano]

C4 Alignment:
------------
         Query: gi|609878487|ref|NM_001291391.1| Homo sapiens ERG, ETS transcription factor (ERG), transcript variant 8, mRNA
        Target: gi|528476536|ref|NC_018932.2| Homo sapiens chromosome 21, alternate assembly CHM1_1.1, whole genome shotgun sequence:[revcomp]
         Model: est2genome
     Raw score: 7669
   Query range: 0 -> 1546
  Target range: 39594417 -> 39332536

        1 : GTTTTCACTTGGTCGGAATGGGGAGAGTGTGCAAGAGATCGCTGCGGGACAGGT :       54
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39594417 : GTTTTCACTTGGTCGGAATGGGGAGAGTGTGCAAGAGATCGCTGCGGGACAGGT : 39594364

       55 : TCCTAGAGATCGCTCCGGGACGGTCGTGACGGCCCCCGAGGGACATGAGAGAAG :      108
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39594363 : TCCTAGAGATCGCTCCGGGACGGTCGTGACGGCCCCCGAGGGACATGAGAGAAG : 39594310

      109 : AGGAGCGGCGCTCAG  >>>> Target Intron 1 >>>>  GTTATTCCAG :      133
            |||||||||||||||++         76685 bp        ++||||||||||
 39594309 : AGGAGCGGCGCTCAGgt.........................agGTTATTCCAG : 39517600

      134 : GATCTTTGGAGACCCGAGGAAAGCCGTGTTGACCAAAAGCAAGACAAATGACTC :      187
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39517599 : GATCTTTGGAGACCCGAGGAAAGCCGTGTTGACCAAAAGCAAGACAAATGACTC : 39517546

      188 : ACAGAGAAAAAAGATGGCAGAACCAAGGGCAACTAAAG  >>>> Target In :      226
            ||||||||||||||||||||||||||||||||||||||++         9093 
 39517545 : ACAGAGAAAAAAGATGGCAGAACCAAGGGCAACTAAAGgt.............. : 39517505

      227 : tron 2 >>>>  CCGTCAGGTTCTGAACAGCTGGTAGATGGGCTGGCTTACTG :      266
            bp         ++|||||||||||||||||||||||||||||||||||||||||
 39517504 : ...........agCCGTCAGGTTCTGAACAGCTGGTAGATGGGCTGGCTTACTG : 39508374

      267 : AAGGACATGATTCAGACTGTCCCGGACCCAGCAGCTCATATCAAG  >>>> Ta :      312
            |||||||||||||||||||||||||||||||||||||||||||||++       
 39508373 : AAGGACATGATTCAGACTGTCCCGGACCCAGCAGCTCATATCAAGgt....... : 39508326

      313 : rget Intron 3 >>>>  GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGT :      345
             130340 bp        ++||||||||||||||||||||||||||||||||||
 39508325 : ..................agGAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGT : 39377955

      346 : TGTTTGAGTGTGCCTACGGAACGCCACACCTGGCTAAGACAGAGATGACCGCGT :      399
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39377954 : TGTTTGAGTGTGCCTACGGAACGCCACACCTGGCTAAGACAGAGATGACCGCGT : 39377901

      400 : CCTCCTCCAGCGACTATGGACAGACTTCCAAGATGAGCCCACGCGTCCCTCAGC :      453
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39377900 : CCTCCTCCAGCGACTATGGACAGACTTCCAAGATGAGCCCACGCGTCCCTCAGC : 39377847

      454 : AGGATTGGCTGTCTCAACCCCCAGCCAGGGTCACCATCAAAATGGAATGTAACC :      507
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39377846 : AGGATTGGCTGTCTCAACCCCCAGCCAGGGTCACCATCAAAATGGAATGTAACC : 39377793

      508 : CTAGCCAGGTGAATGGCTCAAG  >>>> Target Intron 4 >>>>  GAA :      532
            ||||||||||||||||||||||++         21741 bp        ++|||
 39377792 : CTAGCCAGGTGAATGGCTCAAGgt.........................agGAA : 39356027

      533 : CTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCAGCCCAGA :      586
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39356026 : CTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCAGCCCAGA : 39355973

      587 : CACCGTTGGGATGAACTACGGCAGCTACATGGAGGAGAAGCACATGCCACCCCC :      640
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39355972 : CACCGTTGGGATGAACTACGGCAGCTACATGGAGGAGAAGCACATGCCACCCCC : 39355919

      641 : AAACATGACCACGAACGAGCGCAGAGTTATCGTGCCAGCAG  >>>> Target :      682
            |||||||||||||||||||||||||||||||||||||||||++         19
 39355918 : AAACATGACCACGAACGAGCGCAGAGTTATCGTGCCAGCAGgt........... : 39355875

      683 :  Intron 5 >>>>  ATCCTACGCTATGGAGTACAGACCATGTGCGGCAGTGG :      719
            698 bp        ++||||||||||||||||||||||||||||||||||||||
 39355874 : ..............agATCCTACGCTATGGAGTACAGACCATGTGCGGCAGTGG : 39336142

      720 : CTGGAGTGGGCGGTGAAAGAATATGGCCTTCCAGACGTCAACATCTTGTTATTC :      773
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39336141 : CTGGAGTGGGCGGTGAAAGAATATGGCCTTCCAGACGTCAACATCTTGTTATTC : 39336088

      774 : CAGAACATCGATGGGAAGGAACTGTGCAAGATGACCAAGGACGACTTCCAGAGG :      827
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39336087 : CAGAACATCGATGGGAAGGAACTGTGCAAGATGACCAAGGACGACTTCCAGAGG : 39336034

      828 : CTCACCCCCAGCTACAACGCCGACATCCTTCTCTCACATCTCCACTACCTCAGA :      881
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39336033 : CTCACCCCCAGCTACAACGCCGACATCCTTCTCTCACATCTCCACTACCTCAGA : 39335980

      882 : GAGA  >>>> Target Intron 6 >>>>  CTCCTCTTCCACATTTGACTT :      906
            ||||++          867 bp         ++|||||||||||||||||||||
 39335979 : GAGAgt.........................agCTCCTCTTCCACATTTGACTT : 39335088

      907 : CAGATGATGTTGATAAAGCCTTACAAAACTCTCCACGGTTAATGCATGCTAGAA :      960
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39335087 : CAGATGATGTTGATAAAGCCTTACAAAACTCTCCACGGTTAATGCATGCTAGAA : 39335034

      961 : ACACAG  >>>> Target Intron 7 >>>>  GGGGTGCAGCTTTTATTTT :      985
            ||||||++         1911 bp         ++|||||||||||||||||||
 39335033 : ACACAGgt.........................agGGGGTGCAGCTTTTATTTT : 39333098

      986 : CCCAAATACTTCAGTATATCCTGAAGCTACGCAAAGAATTACAACTAGGCCAGG :     1039
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39333097 : CCCAAATACTTCAGTATATCCTGAAGCTACGCAAAGAATTACAACTAGGCCAGG : 39333044

     1040 : TACGAAAACACCCCTGTGTGATCTCTTCATTGAGAGACATCCCAGATGTCCTGC :     1093
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39333043 : TACGAAAACACCCCTGTGTGATCTCTTCATTGAGAGACATCCCAGATGTCCTGC : 39332990

     1094 : TGAGATCCGTGCCCTAAGTCACGTGATACAAAGAGAGCTGATCCCGGAGCTGAA :     1147
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39332989 : TGAGATCCGTGCCCTAAGTCACGTGATACAAAGAGAGCTGATCCCGGAGCTGAA : 39332936

     1148 : GCCAGTCCCAGACAGTCTTATTCTGCCTCTGTTGATTTGGAGACTAAATCCACT :     1201
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39332935 : GCCAGTCCCAGACAGTCTTATTCTGCCTCTGTTGATTTGGAGACTAAATCCACT : 39332882

     1202 : CAAACCATTTCATTCAAAGACCACACTAAAGGAATTAAGAGCAGATTAGCCCTT :     1255
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39332881 : CAAACCATTTCATTCAAAGACCACACTAAAGGAATTAAGAGCAGATTAGCCCTT : 39332828

     1256 : TAACTAGCTTTTCAGAAAGACAGATGGGCAAAGAAGGCATCCTGGATGCCTGGC :     1309
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39332827 : TAACTAGCTTTTCAGAAAGACAGATGGGCAAAGAAGGCATCCTGGATGCCTGGC : 39332774

     1310 : AGTTAGGAATAGGCCGACTTTTGAACTAACAGAAGGATCTGTCCCTCCTCGGGG :     1363
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39332773 : AGTTAGGAATAGGCCGACTTTTGAACTAACAGAAGGATCTGTCCCTCCTCGGGG : 39332720

     1364 : GAAGAGCACAAAACAAGGACACTCCCCAGATTCACAGTGACCGATTATCAGTAT :     1417
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39332719 : GAAGAGCACAAAACAAGGACACTCCCCAGATTCACAGTGACCGATTATCAGTAT : 39332666

     1418 : GTCACAAGAAGCCAGTCTTGCAGAGCAGAAGCATGCAACCAGTAGTATTTACAT :     1471
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39332665 : GTCACAAGAAGCCAGTCTTGCAGAGCAGAAGCATGCAACCAGTAGTATTTACAT : 39332612

     1472 : CTGAATCTTACTGCCTGTCCTCCAAATGATTTAATTAGGTAATAAATTTACATG :     1525
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 39332611 : CTGAATCTTACTGCCTGTCCTCCAAATGATTTAATTAGGTAATAAATTTACATG : 39332558

     1526 : CCATTCATGCAAAAAAAAAAA :     1546
            ||||||||||||||| ||| |
 39332557 : CCATTCATGCAAAAATAAACA : 39332537

vulgar: gi|609878487|ref|NM_001291391.1| 0 1546 + gi|528476536|ref|NC_018932.2| 39594417 39332536 - 7669 M 123 123 5 0 2 I 0 76681 3 0 2 M 102 102 5 0 2 I 0 9089 3 0 2 M 86 86 5 0 2 I 0 130336 3 0 2 M 218 218 5 0 2 I 0 21737 3 0 2 M 152 152 5 0 2 I 0 19694 3 0 2 M 204 204 5 0 2 I 0 863 3 0 2 M 81 81 5 0 2 I 0 1907 3 0 2 M 580 580
-- completed exonerate analysis

Alternatively, you can use an online resource like the UCSC's BLAT page to align the mRNA against the genome. You can see the results here and in the image below:

ucsc blat results

As you can see, our query mRNA sequence (NM_001291391.1) overlaps perfectly with the ERC gene.

$\endgroup$
0
$\begingroup$

There is no one-to-one correspondance between RNA and genes but not so much for the reason you seem to have in mind (although I am not sure what you have in mind).

You should read the wikipedia article on RNA splicing, it will teach you a lot of what you will need to get to the answer you might be looking for.

You might also want to follow an introductory course such as the series DNA to RNA to protein from Khan Academy.

$\endgroup$
  • $\begingroup$ So if I am given an RNA like MIR382, I would not be able to figure out which gene it corresponds to? Because that is what I am trying to do. $\endgroup$ – Bob Aug 14 '16 at 22:17
  • 1
    $\begingroup$ @Bob Just a thought: perhaps try posting your specific question as a separate question, and see if you can get a more specific answer for it. As it is, this current question might be a little too broad or different to get the answer you're looking for. $\endgroup$ – leekaiinthesky Aug 14 '16 at 22:46
  • $\begingroup$ I'll guess that I'll do that, but I don't know if I can get a specific gene corresponding to a specific RNA molecule? $\endgroup$ – Bob Aug 14 '16 at 22:49
  • $\begingroup$ Yes, you can match an RNA to a gene. However, a given gene can yield to different RNAs and different alleles can yield to different or the same RNA. You should have a look at the sources of information I posted above. It is not very long and you'll understand a lot of what you are looking for. $\endgroup$ – Remi.b Aug 14 '16 at 23:19

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.