3
$\begingroup$

I am trying to knockout huntingtin gene from HeLa cells (human epithelial cells). I used CRISPR explorer and benchling.com to determine the best guide RNA sequence that would bind to the target DNA sequence and cas9 could then make the cut. The gRNA I have is as follows:

GGAGGCCTCGGGCCGACTCG Strand (-)

The next step for me is to design the primers with the following sticky ends

Forward primer: 5'-TTGTTGN(19)-3' Backward primer: 3'-ACN(19)AAA-5'

The problem I'm having is writing the oligonucleotide sequence of the primers. Since the gRNA strand is negative, I'm assuming it's a 3'-5' sequence, hence the reverse of it will be the 5'-3' sequence, which I can then just use as the forward primer. Sequentially, I can take the reverse and complement of this forward primer sequence to then determine the backward primer. Is that correct? I appreciate all your help.

Thank you, Abdullah Chaudhary

$\endgroup$
  • $\begingroup$ Is GGAGGCCTCGGGCCGACTCG the output of the gRNA finding software? If so this sequence is most likely 5'→3'. Can you share the output file of the software. If it is an online tool then can you provide the link? $\endgroup$ – WYSIWYG May 16 '17 at 3:49
1
$\begingroup$

A quick check with BLAST returned the following result:

Homo sapiens huntingtin (HTT), mRNA
Sequence ID: NM_002111.7Length: 13669Number of Matches: 1
Related Information
Gene-associated gene details
GEO Profiles-microarray expression data
PubChem BioAssay-bioactivity screening
Range 1: 267 to 286GenBankGraphicsNext MatchPrevious Match
Alignment statistics for match #1

Score           Expect  Identities  Gaps        Strand
40.1 bits(20)   0.017   20/20(100%) 0/20(0%)    Plus/Minus
Query  1    GGAGGCCTCGGGCCGACTCG  20
            ||||||||||||||||||||
Sbjct  286  GGAGGCCTCGGGCCGACTCG  267

The sequence you have is 5'-3' and it matches the Minus strand on the Human genome. You don't need to reverse the sequence!

$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.