Specific primer design

Question

I'm designing primers for species-specific amplification (inside ITS1-ITS2 region). The problem is that when I blast (GenBank) my primer pair, the Forward primer anneals with some isolates (of the same fungus species that i'm targeting) that have one base polymorfism:

Ex:

Predicted Tm= 58-61ºC product length = 189 Forward primer 1 TTCATCTCCGACTCGCATGT 20 Template 130 ........G........... 149

Reverse primer 1 GAATACCAAGGAGCACAAGGT 21 Template 318 ..................... 298

My goal is to amplify only the 100% specific sequences. Would a higher annealing TºC be able to prevent this unspecific binding?

Question 2: The fungus species i'm targeting have isolates with a diversity of polymorfisms (deletions, insertions, one nucleotide substitution,..) and sometimes the predicted amplicon lenght may vary: 189bp, 190bp, 191bp. Will it be problematic for a RT-PCR quantification assay?

Thanks in advance

Answer 1

If your primers are not specific enough, you should design other primers. Try shifting a few bases upstream or downstream. Also, you can add a few extra bases to your primer, you can safely reach 68C as annealing temperature.

If you want your PCR to be able to distinguish a single base mismatch, then the mismatch should occur at the 3' of your primers, ideally one of the three last bases.

If your goal is just to quantify the initial DNA, then RT-PCR will be ok. But if you want to detect the composition of the different polymorphisms, then you should go for sequencing.

Answer 2

Q1: You need to provide more information. How much sequence identity is shared between your target and off-target? What is the purpose of your primers?

Generally, yes a higher annealing temperature would minimise mismatches - you could try a drop-down in T_a for increased specificity during the first few rounds of amplification.

Q2: I doubt it. The difference of 1-2bp is so small that it is highly unlikely to introduce bias.