0
$\begingroup$

I was almost sure I had the right approach to this assignment until I got a variation of answer. Please help to evaluate my approach.

An E. coli promoter has the following consensus sequence (Figure 1) where N refers to any nucleotide and +1 refers to the position where transcription starts ( i.e transcription begins 6 or 7 nucleotides downstream of the -10 box that is shaded; for this gene RNA = ACC...... as shown) enter image description here

Now examine the sequence (figure 2) below and answer the following questions: enter image description here

  1. Which strand (top or bottom) is the coding strand for this gene if the -35 and -10 regions of its promoter are highlighted as shown in the figure above?

Bottom strand as the promoter sequence TATAAT (-10 sequence) goes from R to L (TAATAT) so the orientation of the coding strand is R to L - 5' to 3'.

  1. Write the first 10 nucleotides of the RNA that will be produced if the -35 and -10 regions of its promoter are highlighted as shown in the figure above.

Since the transcription always begins at +7, the first 10 nucleotides comes from the +7 position of the bottom strand(being the coding strand) - 5' AAGAUUCAUC 3'

Suppose the RNA that is produced is whatever you have written in Q2 following by the sequence shown below. Stitch the RNA fragment you have written for Q2 to the sequence below and then answer the next questions.

5' CGAGUGCCAUGCCUGGUCUAAGGAGGUAUGAGUAAUGUUGUAAAAUAGUUAGUCUAC 3'

Since RNA is always stitched at 3' end, the new sequence would be: 5' CGAGUGCCAUGCCUGGUCUAAGGAGGUAUGAGUAAUGUUGUAAAAUAGUUAGUCUAC***AAGAUUCAUC*** 3'

The part in italicized bold is the stitched part from the previous question.

  1. Label the segment of this RNA that would correspond to the 5' UTR, the ORF and the 3' UTR of this RNA is E.Coli.

5' CGAGUGCCAUGCCUGGUCUAAGGAGGUAUGAGUAAUGUUGUAAAAUAGUUAGUCUACAAGAUUCAUC 3'

SD sequence - UAAGGAGGU

So 5' UTR - CGAGUGCCAUGCCUGGUCUAAGGAGGU

ORF - AUGAGUAAUGUUGUAAAAUAG

3' UTR - UUAGUCUACAAGAUUCAUC

  1. Label the modifications that this RNA would undergo if it were produced in a eukaryote (assume there are no introns).

5' UTR - CGAGUGCC

ORF- AUGCCUGGUCUAAGGAGGUAUGAGUAA

3' UTR - UGUUGUAAAAUAGUUAGUCUACAAGAUUCAUC

Since there are no introns, the mature mRNA would look like -

5' methylated G cap - 5'UTR - ORF - 3' UTR - poly A tail 3'

$\endgroup$
  • $\begingroup$ You have the first part of the transcript from figure 2, now the exercise gives you the rest. Forget the word "stitch". Also, think about what you are doing. How could the first 10 nucleotides end up at the 3' end? $\endgroup$ – Inhibitor Apr 16 '18 at 2:11
  • $\begingroup$ While it's true that RNA is transcribed 5' to 3', it's also important to note that the directions state: > Write the first 10 nucleotides of the RNA that will be produced ... Suppose the RNA that is produced is whatever you have written in Q2 following by the sequence shown below. Sometimes the directions for an assignment trump the biology of the assignment, and it becomes a semantics problem. Very troublesome, and I would clarify the directions with an instructor or TA. Second, the shine-dalgarno sequence for E. coli is typically AGGAGGU, and is actually part of the 5'-UTR. $\endgroup$ – CKM Apr 16 '18 at 15:02

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Browse other questions tagged or ask your own question.