0
$\begingroup$

I have came across a few genes that show different nucleotide sequence in different databases. I then found out that the sequences are actually reverse complement of each other. How do i determine which is the actual nucleotide sequence of a gene,and not the reverse complement version of it?

$\endgroup$
  • 2
    $\begingroup$ Usually the reported sequence for a mRNA in NCBI is the sense strand. Can you give an example of a gene whose sequence you are unsure of? $\endgroup$ – WYSIWYG Apr 30 '18 at 9:28
  • 2
    $\begingroup$ Possible duplicate of What direction is a sequence in databases written? $\endgroup$ – David Apr 30 '18 at 11:41
  • $\begingroup$ Hi @WYSIWYG below are the nucleotide sequences of the rplC gene. The first one is from NCBI, while the second I received from a sequencing company for my strain: >ATCC 19977 R rplC ncbi CTACTTCTCACCTCGCTTGACAGCGGTGCGGACCACAACCAAGCCACCCTTACGTCCGGGGATGGCACCC TTGATCAGCAGTACGCCGTTCTCGGCATCGACCTTGTGCACCACCAGGTTCTGAGTGGTGACGCGATCGC TACCCATACGTCCGGACATCCGGGTGC >M61 S ATGGCAAGAAAAGGAATTCTGGGCACCAAGCTGGGTATGACGCAGGTGTTCGACGACAAC AACCGGGTTGTCCCGGTAACCGTCGTCAAGGCCGGCCCCAATGTGGTGACCCGCATCCGG ACCACCGAGCAGGACGGCTACAGCGCCGTGCAGCTCGCGTATGGCGAGATCAGCCCCCGC AAGGTGACCAAGCCGGTCACCGGTCAGTTCGCCGCCGCGGGC $\endgroup$ – Skyd4ncer May 2 '18 at 7:06
  • $\begingroup$ It's really important for me to know the exact sequence, as i am looking for a nucleotide change at a specific location $\endgroup$ – Skyd4ncer May 2 '18 at 7:10
0
$\begingroup$

You run a blast of your sequence. Then explore the results and you'll see somewhere that says "strand" and is indication whether is plus/minus.

https://blast.ncbi.nlm.nih.gov/Blast.cgi

Also blast has a graphical interface in which you'll clearly see the matching and non-matching bases. Therefore it should help you to identify the differences between the 2 sequences.

$\endgroup$
0
$\begingroup$

In general, if you look up a transcript sequence it will be in the correct orientation. If you look up a gene based on genomic coordinates, it may not be.

We can't tell you why your first sequence is in the wrong orientation from what you pasted.

$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.