0
$\begingroup$

What tools are available to estimate the function and purpose of a gene ? I think the right approach is to find similar sequences of genes that we know the function of.

All the information I have on a gene is (for example):

KXN84633.1

and

>lcl|Query_208731:23119-24312
CTACAGACATATCCCATCCAGAAGAAATCTTTATCTATCGAATACCTTCGCGATAACGCGTATCTACGCG
CTCGAACAGGCCAAATAGCTGCAATGTTAAGGCTGAGGGATAGTATTTCCAAAAACCTATCCCGGCATTT
TGAGGTACATTTACTTTCTTCCGTATCTGGCCTGACTAAAAATCCTGCGTAGTCTCAAGGGTTTACATAT
ACTCATACGCCTATAATAACAGCTAGCGATTGCGAAGGCGCAGGCGAAGCATTTCGCATATCACCTATCC
AACCTACCACCCCCTCTCTCTCAAAAACTGACGCAAGTTCAGACGCAAATACCCCTATAGAGTTCTTTTC
ACGTCCTGCATATCTCACAGTCTCGCATCAACTTCATCTAGAATCCTTCACCACGGCTCTCTCTCGCGTG
TATACCCTTTCACCATGTTTTCGTGCGGAACGATCTATGACTGGACGACATCTGGCCGAGTTCTGGATGC
TTGAGGCCGAGTGGAACCTTGCAACGCGTTGCGATAGCTTAGAAGAAATTTGTGCCTTTGTGGAAGGCTT
AATTCGGACGTCGGTAGATCATGAGTCGCAGGATGTCAAGGCTCTGTGGGCGGAGAAAGGAGCGGAAGTA
GAGGAATTCAAGATGTTTCGTGCCGCATTTGACAACGCTCAGCCTTGGAGGCGATTAACATACTCGGATG
CAGTCGAGGCGTTGAGCACGGCTTATGTCAACGGACATCCTTTCGAATTCAAACCTGTCTGGGGCGAATC
ACTCTCGAGCGAACATGAACGTTGGCTGGCAGAGGTGTACGTTGGTGGACCAGTGTTCGTGACAGACTAC
CCTATCAAACTTAAACCGTTTTATATGCGGGTCAACGAAGATGGGAAAACCGTTGCGTGTTTCGATTTGA
TTGTACCTCATGCTGGTGAACTTGTGGGTGGAAGTGTGAGGGAGGAGAGATGGGATGTCCTCTCAAAACG
GATGGCAGAGCATGGATTGTTGCCTCACCCTGACCAGAATGAGGGTGCCCCAACTGATTCGACATATGAA
TGGTATCTGGATTTACGCAAGTATGGTGGAGCGCCGCATGCAGGGTTTGGTCTTGGGTTTGAAAGGCTGG
TGAGCTGGGTTGGAGGGATTGACAATGTGCGAGAATGCATCGGCATGCCTCGGTGGACTGGGAGAATGAT
TATG
>lcl|Query_208731:22646-23071
ATGCTCCTTCGCAGGTTATACTCGACTGCTGCACATCCTGCCAGGTTCAAACTACCGCCGACAATCAAAC
AGGTGCTTTCAGCTAATGGCAGCGAAAGTTCAGCGACATCAGTGACTGGCTGGATTAAATCTATCCGTAA
ACAGAAAAACATAACCTTCGCTGTAGTCAGTGATGGTACAACACCAGAGGGCCTGCAAGCAGTTGTGTCA
AAAGAACAGGGTACTTCCCCAGAAATGTTGAAAAGGTCAGTTCATCTCTCACAGCTCGAAACCGGAACAC
TCACCAATTGAAGACTTACGAACGGTACAGCAGTGCGGCTCACAGGAAATCTAATTCAGTCTCCTGGCCG
AGGTCAAGAATGGGAGCTTGTCATTCAAGAAGGTGACAAGAACGCTATCGAAATCCTCGGCGACTGTGAT
ATTGAC
>lcl|Query_208731:c22559-22323
ATATCACATTCAACATCCAGGGTAATGACATCGCCATGTCGCTAGACAGCGTCGACAATGACTTCCAAGA
AACACTCGTTCCCATCTCCACTGGAATCTCTCTGGAACTCGATCTTATCAAACCCCGTCAACCGCAAGAG
CAAGAGTCCAAACTAGCAATCTGTCTTCACCCCTGGTCTCGACTCGGAGGACGCAAAAGCGACCCGTGCG
GTGTCTTATTCCACGAGCTCAGGTCGA
>lcl|Query_208731:c23949-23902
CACGAACACTGGTCCACCAACGTACACCTCTGCCAGCCAACGTTCATG

obviously I am new to this :) 
$\endgroup$
  • 2
    $\begingroup$ This sounds like a homework question, although your previous posts perhaps suggest otherwise. In any case, you should give us a bit of background. Where did you get what looks like an accession number (that I can't find on the internet) and these sequences (which I can) — why the Query annotation? Have you searched the internet for methods to compare an unknown sequence with known ones. We can tell you, but our homework policy would have you try yourself first. $\endgroup$ – David Aug 25 at 9:26
  • $\begingroup$ I'm just a software developer having a little dabble to see what I can get to. It is indeed a button mushroom gene. $\endgroup$ – user2728841 Aug 26 at 11:17
1
$\begingroup$

I personally do not find the second part with the queries helpful without greater context.

The first part appears to be an accession number (more information on these can be found here: https://www.ncbi.nlm.nih.gov/Sequin/acc.html). By going to NCBI (https://www.ncbi.nlm.nih.gov/) and searching that accession number, you can get a lot of information quickly and easily. Searching this particular number shows it to be a Asparagine-tRNA ligase from the fungal genus Leucoagaricus (https://www.ncbi.nlm.nih.gov/protein/KXN84633.1/).

If you simply have a DNA or protein sequence and no accession number, you can perform a BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). This will search your sequence against a massive database of annotated DNA or protein sequences. The specific type of BLAST to run and the ideal parameters will take some reading on your part to determine. However, if you're just starting out, nucleotide BLAST for DNA sequences, protein BLAST for protein sequences, and default parameters will often suffice. This search will provide you with the best "hits" to the database which you can then follow up on to get an idea of the function of your original sequence.

$\endgroup$
  • $\begingroup$ thank you, that may do the trick. $\endgroup$ – user2728841 Aug 26 at 11:16

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.