Let’s say you have the following DNA sequence fragment:
5’-ACCAGTACTTCGT-3’
3’-TGGTCATGAAGCA-5’
Is there any way to determine which strand is the template strand and which is the coding strand for RNA synthesis solely from the above information?
$\begingroup$
$\endgroup$
-
1$\begingroup$ There are two main problems with your post. First it lacks any sort of context: why this sequence, is it eukaryotic or prokaryotic, are you looking for promotor sequences, is it a homework question and what research have you done yourself to try to answer your question? It sounds very much as if you don't really know what you are asking and have made no effort to read about the topic, otherwise you would know that the answer is No. The second problem is terminology. Template for the mRNA transcript of a gene meaningful, but unusual terminology; coding strand is ambiguous. Please clarify. $\endgroup$ – David Dec 30 '19 at 23:22
$\begingroup$
$\endgroup$
I don't know about your specific example (perhaps look for triplets that code start codons?), but machine learning has been used to predict promoters from sequence information (from promoter regions, you get downstream initiation of transcription of DNA to RNA). You would probably need more sequence to predict a promoter with more certainty. Cites: https://en.m.wikipedia.org/wiki/Promoter_(genetics) and https://academic.oup.com/bioinformatics/article-abstract/35/16/2730/5270663
$\begingroup$
$\endgroup$
Given a DNA sequence alone, you can annotate open reading frames (ORFs) in order to identify the coding strand, with the caveat that not all ORFs are genes. ORFs are sequence segments that begin with a start codon (ATG) and end with a stop codon (TAA, TAG, TGA) when read from 5' to 3' in 3-base codons. There are no start or stop codons in either strand of the short sequence you provide, so I've appended a new example sequence:
DNA :
5' - AGGATGCAGGAGTGGTACGATTTATCCTAGGAACCT - 3' <-- Coding strand
^^^ ^^^
Start Stop
3' - TCCTACGTCCTCACCATGCTAAATAGGATCCTTGGA - 5' <-- Template strand
RNA :
5' - AUGCAGGAGUGGUACGAUUUAUCC - 3'
Note that the start and stop codons given are part of the standard nuclear genetic code shared by eukaryotes, and there are alternative genetic codes used in prokaryotic and mitochondrial DNA transcription.
$\begingroup$
$\endgroup$
The answer is simple : promoter
the promoter is a non-coding sequence of DNA found on one strand of the DNA when reading from (5'->3') which is to be the template strand .
For example the (TATA) box is found in prokaryotic cells DNA (also named prinbow) and in eukaryotic cells DNA .In eukaryotes, It has the following sequence (5'...TATAAA....3') and is centered (-20-30 bp/20-30 bp upstreaming away from the coding sequence of the gene) it is the sequence to which the transcription factors and RNA polymerase II bind initiating the transcription process.
