4
$\begingroup$

The reference genome in GenBank of the sars coronavirus from Wuhan is written in the following format: 

attaaaggtttataccttcc

(The first 20 nucleotides)

Considering that coronaviruses are RNA viruses, the bases of which are adenine, cytosine, guanine and uracil, I was surprised to see the t symbol in the sequence, which stands for thymine, found in DNA, not in RNA. Additionally, no u symbols are present in the sequence.

So, what's going on here? Where did Thymine come from, why no Uracil?

Improve this question
$\endgroup$
3
  • 3
    $\begingroup$ RNA is sequenced by reverse transcribing it to cDNA, and this is the sequence that is submitted. In fact, I don't think I've ever seen a sequence in NCBI specifying uracil instead of thymine (not that I've looked). $\endgroup$
    – canadianer
    Commented Apr 5, 2020 at 3:19
  • $\begingroup$ Thanks! Some further questions persist. Is this cDNA ever present in nature or is it an artifact of the secuencing procedure? Are there any other differences between ARN and the transcripted cDNA? $\endgroup$
    – TZubiri
    Commented Apr 5, 2020 at 4:35
  • $\begingroup$ Retroviruses naturally have cDNA as part of their life cycle. The mechanism of retrotransposon transposition also involves cDNA. In this case, it’s just due to the sequencing method. $\endgroup$
    – canadianer
    Commented Apr 5, 2020 at 4:58

1 Answer 1

Reset to default
7
$\begingroup$

It would appear that the current policy at GenBank is to represent all genomic sequences as DNA, even though this is not made explicit in any of the easily retrievable documentation on their website or in their publications. The way in which one determines the nature of the genome is from the first (LOCUS) line in the report, which, in the case of SARS-CoV-2 is:

LOCUS       NC_045512              29903 bp ss-RNA     linear   VRL 30-MAR-2020

The ss-RNA indicates a single-stranded RNA genome.

The only indication I could find that this might be GenBank policy was a reference to the fact that a separate RNA division of GenBank used to exist, but was discontinued in 1999:

The RNA division of GenBank was removed in release 113.0 (August 1999). Sequences that were previously in the RNA division have been moved to the appropriate organismal division.

The genomes of certain RNA phages were originally sequenced as RNA (as were bacterial rRNAs and 18S rRNA) — that of phage MS2 was the first in 1976. The GenBank entries for these are currently in DNA format. Thus V00642.1 contains references to the 1976 MS2 paper by Fiers et al., but is in DNA format. As GenBank was not established until 1982 it is not clear whether the original entry in GenBank was in RNA or DNA format.

UPDATE 15.04.2020

I wrote to GenBank to ask them whether there was a specific policy and if so when it had been introduced. I had a reply from someone on their help desk to the effect that GenBank policy was that of International Nucleotide Sequence Database Collaboration, the shared rules of which includes table "7.4.1 Nucleotide base codes (IUPAC)". This states that "t" can represent thymine in DNA and uracil in RNA. However my respondent could not find out whether this representation was used in GenBank for RNA viruses from the beginning or introduced later. As originally GenBank releases were on CD-ROM this is difficult to check.

Improve this answer
$\endgroup$
2
  • 3
    $\begingroup$ It's not GenBank's policy, it is a long standing tradition in molecular biology to express sequences in DNA form. $\endgroup$
    – TumbiSapichu
    Commented Apr 5, 2020 at 11:45
  • 4
    $\begingroup$ @TumbiSapichu — unsubstantiated assertions are valueless on SE Biology. If you read my post you will see that RNA sequences were determined before DNA sequence methodology emerged, and that originally they were stored in databases as RNA. I was there and remember it. So much for "traditions in molecular biology"! For ribosomal RNA and tRNA it is still necessary to have databases with the actual bases because many are modified. $\endgroup$
    – David
    Commented Apr 5, 2020 at 12:27

You must log in to answer this question.

Not the answer you're looking for? Browse other questions tagged .