1
$\begingroup$

I understand that nsp12 is the RdRp protein in the ORF1 of SARS-CoV2 genome. And nsp12 starts from the starting nucleotide base of orf1ab. Could you please tell me the exact genomic location coordinate of RdRp?

Is there and database from where the FASTA sequence (nucleotide and aa) of RdRp of SARS-CoV2 can be obtained?

Any answer to this question would be highly appreciated.

$\endgroup$
2
$\begingroup$

The following is a standard and quite straightforward way to obtain the information requested that is generally applicable and does not require any programming.

  1. Go to the NCBI website or its Genbank page, select Genome from the pull-down menu and type your search term, ‘SARS-CoV2’ into the search field:

Genbank Genome search box

  1. On clicking Search, you will be taken to a page with a brief summary of information about the genome. In the Reference genome summary box click on the RefSeq ID, NC_045512_2:

Reference Genome Summary box

  1. This takes you to the record for the nucleotide sequence of the virus genome. Scroll down (or do a Find in your web browser) to the gene of interest, nsp12. There you will find an entry with the genomic co-ordinates (13442–13468 and 13468–16236) and a cross-reference to the protein, [YP_009725307.1(https://www.ncbi.nlm.nih.gov/protein/1802476815).

nsp12 entry

  1. If you click on that ID you will be taken to the Genbank entry for the protein encoded by nsp12, with the sequence in FASTA format.

Protein entry for nsp12

You can download a file containing the sequence from the Send to pull-down shown. There is also a link to the graphical interface for viewing the protein in the context of the genome (available from the nucleotide sequence page as well).

| improve this answer | |
$\endgroup$
  • $\begingroup$ This is more informative. $\endgroup$ – Sk Sarif Hassan May 19 at 16:17
  • $\begingroup$ Tks I didn't notice the hidden entries 1 and 2 $\endgroup$ – reuns May 20 at 14:05
4
$\begingroup$

A useful database and exploratory tool is the UCSC Genome Browser wuhCor1 assembly browser instance.

A synonym for nsp12 is Pol. Its position range in the wuhCor1 assembly is NC_045512v2:13,442-16,236.

There are several ways to extract sequence, but one programmatic way is to get the FASTA from UCSC Goldenpath for the assembly, and extract the characters of interest from the position range for the gene of interest using standard Unix tools:

$ wget -qO- ftp://hgdownload.soe.ucsc.edu/goldenPath/wuhCor1/chromosomes/NC_045512v2.fa.gz | gunzip -c | tail -n+2 | tr -d '\n' | cut -c 13442-16236 | awk '{print ">nsp12"; print $0}' > nsp12.fa
$ cat nsp12.fa
>nsp12
TCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAAATTCCTAAAAACTAATTGTTGTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTTGTAGTTAAGAGACACACTTTCTCTAACTACCAACATGAAGAAACAATTTATAATTTACTTAAGGATTGTCCAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGACGGTGACATGGTACCACATATATCACGTCAACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATTTTGATGAAGGTAATTGTGACACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAATAAAAAGGACTGGTATGATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTGTACGCCAAGCTTTGTTAAAAACAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACTGACATTAGATAATCAAGATCTCAATGGTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTGTAGATTCTTATTATTCATTGTTAATGCCTATATTAACCTTGACCAGGGCTTTAACTGCAGAGTCACATGTTGACACTGACTTAACAAAGCCTTACATTAAGTGGGATTTGTTAAAATATGACTTCACGGAAGAGAGGTTAAAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACATACCACCCAAATTGTGTTAACTGTTTGGATGACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTGTTCCCACCTACAAGTTTTGGACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGGATACCACTTCAGAGAGCTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTTAAGGAATTACTTGTGTATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAACGCACTACGTGCTTTTCAGTAGCTGCACTTACTAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAACAAAGACTTCTATGACTTTGCTGTGTCTAAGGGTTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTCTTTGCTCAGGATGGTAATGCTGCTATCAGCGATTATGACTACTATCGTTATAATCTACCAACAATGTGTGATATCAGACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTTGATTGTTACGATGGTGGCTGTATTAATGCTAACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAATAAATGGGGTAAGGCTAGACTTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAAAACGTAATGTCATCCCTACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTCTCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCAATAGCCGCCACTAGAGGAGCTACTGTAGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTGTTTATAGTGATGTAGAAAACCCTCACCTTATGGGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAACATGCTTAGAATTATGGCCTCACTTGTTCTTGCTCGCAAACATACAACGTGTTGTAGCTTGTCACACCGTTTCTATAGATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAAGCTGTCACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTCCGCAATTTACAACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATGAGTTTTACGCATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTGTTTCAATAGCACTTATGCATCTCAAGGTCTAGTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTATCAAAACAATGTTTTTATGTCTGAAGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATACAATGCTAGTTAAACAGGGTGATGATTATGTGTACCTTCCTTACCCAGATCCATCAAGAATCCTAGGGGCCGGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACACTTATGATTGAACGGTTCGTGTCTTTAGCTATAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTCTTTCATTTGTACTTACAATACATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGTTATGCTTACTAATGATAACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCATACAGTCTTACAG

Another option is to visit the Pol link again and look for the "View DNA for this feature (wuhCor1/SARS-CoV-2)" link, click on it, and click on "get DNA" to get a similar FASTA file. But if you're going to do bioinformatics, knowing how to string together Unix tools is a valuable skill.

To get the amino acid sequence, visit the Pol link, look for the Swiss-Prot record information, and do a search through UniProt for the record P0DTD1.

Via the "RNA-directed RNA polymerase" entry for P0DTD1, you can click on the "RNA-directed RNA polymerase" post-translation product to get to a record with the amino acid sequence: https://www.uniprot.org/blast/?about=P0DTD1[4393-5324]&key=Chain&id=PRO_0000449629

| improve this answer | |
$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.