2
$\begingroup$

I am interested in using the CI and Mnt proteins as well as their respective promoters (pR and Pmnt) within the same synthetic system, but am concerned as to their similarity and potential crosstalk. A quick search of the literature yielded no results and a Multalin did show some significant sequence homology (although Mnt forms a homodimer while CI does not).

CI and Mnt Multalin

pR and Pmnt Multalin

Sequences: CI and pR, Mnt repressor and Mnt promoter

Has it ever been reported that the CI or Mnt repressor exhibit crosstalk on the pR and Pmnt promoters?

$\endgroup$
1
$\begingroup$

There are no reports for it yet. I don't think just because they show overall homology, they would exhibit crosstalk. Just see the alignment of the DNA binding domains of these proteins first ~70 residues from N-terminal. Moreover their DBDs belong to different PFAM families.

Similarly with the promoter sequences. As reported in iGEM website:

  • Mnt promoter: tagatctcctatagtgagtcgtattaattt

  • cI promoter: gtgttgactattttacctctggcggtgata

They are quite different. Moreover, if iGEM has a reported standard part such as a bistable system component: Mnt/cI promoter (BBa_K228003) then it would have been pretty much standardized. iGEM parts are usually reliable.

$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.