Questions tagged [bioinformatics]

The science of collecting and analyzing complex biological data such as genetic codes using informatics.

Filter by
Sorted by
Tagged with
0
votes
1answer
7 views

Why are Ramachandran angles of first and the last amino acid not necessary to define the full 3D structure of a protein chain?

I have come across an online ppt slide of the bioinformatic algorithm where it is said that first and the last amino acid Ramachandran angle is not necessary to tell all its internal coordinates. Is ...
0
votes
0answers
4 views

Generating Cartesian coordinates of each atom in protein chain from the internal coordinates using python or some software

I am trying to compute Cartesian coordinates of backbone atoms and side-chain atoms (C beta alone) for a given set of internal coordinates (bond lengths, bond angles and dihedral angles) I have ...
0
votes
0answers
17 views

Creating a phylogenetic tree from my selected publicly-available sequences (WGS) in NCBI

I'm currently writing a paper on the comparison of virulence genes for a group of bacteria. I got my data from publicly-available whole genome sequences in NCBI. Now, I want to create a phylogenetic ...
1
vote
1answer
38 views

Help Finding Specific BlaZ Gene Type Sequences on Genbank

I am doing an undergraduate research project that involves blaZ gene typing for different strain types of Staphylococcus aureus bacteria; for reference, here are some of papers on this topic that ...
0
votes
0answers
20 views

How can we simulate Recombination on bp level given 2 DNA strings?

I am wondering if there is a model to simulate how the DNA recombine ? for example: parent A: "CAGCTACAGCTATAGCAGCTCAGCTATAGATAGCAGCTATAGCAGCTATAGCAGCTATAGTAG" parent B: "...
0
votes
0answers
22 views

How can we estimate how many generations have passed between two individuals?

I am taking a course in Bio Informatics, but my biology knowledge is pretty limited. So a question raised for me. Let's suppose we have a pair of aligned sequences, how can we estimate how many ...
1
vote
2answers
31 views

Metrics to analyze branch lengths in phylogenetic trees

I'm interested know about some basic metrics that could be used to discriminate trees based on their branch lengths. I know of branch length unaware topological/tree shape-based methods such as ...
1
vote
1answer
31 views

Would there be more amino acid residues in the extracellular or intercellular space?

I am working on a bioinformatics project with HMMs and want to write some initiation probabilities for the location of amino acid residues. I know for different transmembrane proteins there will be ...
0
votes
2answers
100 views

What exactly is “chromosome topology”?

I've been reading a lot about Hi-C lately, and this has been bothering me. So far as I can tell from reading around, the topology is related to the conformation of the linear chromosome. This seems ...
-1
votes
2answers
59 views

How can I classify the 3 clades(S, G, V) of the coronavirus that are found on GISAID?

On GISAID they classified the corona using 4 clades(S, G, V, Other). I would like to know exactly how these genomes were classified for my research. So how do you classify a coronavirus genome as ...
2
votes
1answer
29 views

DNA extraction kit for microbial mats, rocks, and soil in a remote area

I am hoping to perform a metagenomics study of samples from a lava tube. It will be in a remote area (with no large scientific equipment) and I would need to bring all scientific equipment myself. For ...
-1
votes
1answer
65 views

How to identify an unknown species from a .fasta file containing its genome sequences [closed]

I am a Biochemist that is unfamiliar with bioinformatic tools and new to academia as a whole. I am currently using ILLUMINA PE DNA sequence data, which I trimmed (Trimmomatic), corrected (Rcorrector) ...
1
vote
0answers
35 views

NCBI blast for exact match of short sequence

I'm trying to Blast for exact matches to the sequence: 'ATTGNNNNGCAAACCA' in the human transcriptome using NCBI Blast on its 'refseq_rna' database. However, when I do a basic query I get "No ...
0
votes
0answers
11 views

Term for context based behavior?

Is there term in neuroscience that describes change in neuronal circuits depending on context: low sugar/fear/... => hormones => different pathways of behavior ...? I know that is something from ...
3
votes
1answer
71 views

Rigorous definition of the kinship coefficient and proof of a recursion thereof

I am reading Section 5.2, Kinship and Inbreeding Coefficients, of Kenneth Lange, Mathematical and Statistical Methods for Genetic Analysis. There the kinship coefficient $\Phi_{i,j}$ is defined for ...
15
votes
1answer
314 views

At which step should I apply a detection filter when preprocessing microarray data? (Before/After normalization, batch effects removal)

What is the best practice when preprocessing microarray data using a detection filter (on scanner p-value)? Suppose I have a microarray dataset that I have to normalize with Loess and correct with ...
25
votes
1answer
2k views

Additive genetic variance components from LMER in R

I've set up some dummy data in R which makes 40 genetically related lines, they are all siblings within a line so are genetically related by a factor of ½ thus additive genetic variance should be ...
0
votes
1answer
52 views

How to reduce the number of sequences in a Multiple Sequence Alignment?

I have a Multiple Sequence Alignment, where there are around 5000 sequences. There also exists many sequences where, there are so much of non-sequenced regions (for instance, AU----CGGGCA--NNNNNNNNNN)....
0
votes
1answer
52 views

Is there a negative correlation between the mRNA produced by the cell and the time of extraction? [closed]

I am doing some data analysis about gene expression time series. When I plot mRNA produced by P. Furiosus cells irradiated by gamma radiation against the time of extraction, it seems that there is a ...
0
votes
0answers
26 views

What does an allele frequency of 0 mean in gnomAD v3?

There is a single nucleotide variant: 18-47394-G-A (GRCh38) with an allele count and allele frequency of 0. As I understand it, this means that there are no alleles in the population with this variant,...
4
votes
3answers
408 views

What could I call such nucleic-acid-Sequence? A sort of palindromic sequence? is there any term called mirror repeat?

5'... ATGCC|CCGTA ...3' 3'... TACGG|GGCAT ...5' or say 5'... AAGT|TGAA ...3' 3'... TTCA|ACTT ...5' or in generalised way; on each strand; ABCDEF|FEDCBA Is there any terminology for such-sort ...
2
votes
1answer
81 views

Extract mutations from fasta sequences

I have a large amount of protein sequences in the .fasta format and I would like to extract only the amino acid mutations from these sequences, so that, in the end, I want to have a list that looks ...
-1
votes
1answer
14 views

What is the best way to find which domains in a list of InterPro IDs are catalytic?

What is the best way to find which domains in a list of InterPro IDs are catalytic? (In this case, we are looking at human enzymes and their domains' InterPro IDs.) Thanks in advance! Setz
0
votes
1answer
64 views

What is the energy required for storing and performing computations in synthetic computational biological cells?

I want to know the energy costs of various computations performed through synthetic biological circuits in terms of ATP. I am primarily interested in storing of bits, addition, and multiplication ...
-1
votes
1answer
52 views

Why do doctors reccommend vegetable oils in high cholesterol and cardiovascular disease?

As there is high cholesterol in body why the patient need more fats and why the doctors are recommending it Transcribed: Vegetable oils are rich in polyunsaturated fatty acids (PUFA). The fatty acids ...
48
votes
4answers
7k views

What exactly are computers used for in DNA sequencing?

I've thoroughly read the Wikipedia article on DNA sequencing and can't get one thing. There's some hardcore chemistry involved in the process that somehow splits the DNA and then isolates its parts. ...
1
vote
1answer
53 views

BLAST, using Smith-Waterman in the last step and S-score

In my bioinformatics course we studied the BLAST agorithm. After finding the HSP's and joining the HSPs together that are close enough and in a correct diagonal trend, we perform a next step: namely a ...
0
votes
0answers
12 views

Is there a way for POPart to accept indels in chloroplastidial genes?

I need to construct a network concerning chloroplastidial genes using POPart. My problem is that POPart does not know how to deal with indels. I have already coded them using SeqState (simple indel ...
0
votes
2answers
125 views

Simple protein graphics software for stick models

Anybody know of a good free molecular graphics system that allows PDB file input? I prefer that it does not use Java. I also prefer that it is online, although I would consider recommended software ...
0
votes
0answers
20 views

Examining antibody - target interactions in PyMOL

I'm a student currently looking at antibody responses against a viral target protein of interest. I have my own, annotated PyMOL session of my protein and I also have .pdbs of crystallised antibody ...
-1
votes
1answer
25 views

What is multiplet nuclei capture rate?

I met this terminology in a publication.https://core.ac.uk/download/pdf/226940818.pdf. It's in the last sentence of the second paragraph in the text. I tried to search for it but didn't get a ...
7
votes
5answers
2k views

Does anyone know good software for producing tanglegrams?

I'm trying to look at relationships between parasite and host phylogenetic trees. I have done a bit of searching for software with which to do this, and I have tried using Dendroscope and TreeMap, but ...
1
vote
1answer
27 views

Why the major gene model can be supported by finding de novo mutations in affected cases?

I found a sentence which I can't fully understand in a publication on the genetics of autism. The unified major gene model is supported by the significant increase in damaging de novo mutations ...
-1
votes
1answer
57 views

How to download omic data from ncbi? (SRA data or any suggestion?)

I proposed myself to replicate the results in this paper with an accession number PRJNA325650. So, I'm trying to download the data. Which will be the best way to do this?. I tried with the sratoolkit, ...
0
votes
2answers
24 views

Assessing beta diversity variations with time

I'm just starting in the field of ecological statistical analysis and I have a few doubts regarding a dataset that I'm working on. The dataset is composed of several samples collected at a single ...
0
votes
0answers
26 views

Who define the SARS-CoV-2 haplotypes?

If you look in this paper https://www.nejm.org/doi/full/10.1056/NEJMoa2006100 they work with several haplotypes of the virus. They claim that the definitions of the haplotypes come from GISAID/...
0
votes
0answers
10 views

Question about Interpreting from IGV

Hello I am a complete beginner with zero knowledge of bioinformatics taking a class on it offered by my dept. I have a screenshot of my IGV of 5 genes that I used from human genome 38. I simply ...
7
votes
2answers
6k views

Scoring matrices (BLOSUM & PAM) in BLAST and other sequence-comparison programs

The Wikipedia page on BLAST states that: The scores are created by comparing the word in the list in step 2* with all the 3-letter words. By using the scoring matrix (substitution matrix) to score ...
1
vote
0answers
45 views

How large a part of the corona-virus is coding?

If you find an example of a sequenced string of coronavirus it is about 30.000 long. Looking for example here https://nextstrain.org/ncov/europe you'll see that by far the largest part of this is ...
0
votes
1answer
42 views

blast search against UNIPROT

I would like to ask how i can search in blast against UNIPROT (TREMBL PLUS SWISSPROT) for a selected organism. In the BLAST site there is no option about UNIPROT(only Swissprot), and in the uniprot ...
0
votes
0answers
16 views

Lineage inference based on N randomly partitioned copies of a gene

I am interested in reconstructing cell lineages based on the sequences of randomly partitioning plasmids. I can find lots of models to build lineages based on a single sequence (e.g. bacterial gene) ...
4
votes
1answer
1k views

What is structural RNA?

In genbank (ftp://ftp.ncbi.nlm.nih.gov/genomes/archive/old_refseq/Fungi/Saccharomyces_cerevisiae_uid128/) there are an archive .frn (nucleotide sequences of structural RNAs in fasta format), and I ...
33
votes
1answer
4k views

I just had my genome sequenced. Can someone tell me what these different file formats are?

I just had my whole genome sequenced and now I want to play a bit with bio-informatics. However, the documentation is quite scarce on the file standards used. These are the files I have been given (...
-1
votes
3answers
165 views

Where are there analyzable signed directed network datasets?

I'm looking for biological datasets with specific properties that are available for me to analyze. Informally put, I have a hammer and I am looking for a nail. That is to say, I have an algorithm and ...
0
votes
1answer
17 views

Relationship of RNA-binding proteins to peptidyl-prolyl cis-trans isomerase [closed]

I am studying a Plasmodium gene, known to encode an RNA-binding protein. However a BLAST search brings up mainly peptidyl-prolyl cis-trans isomerases from other species. Why would this be so?
0
votes
0answers
10 views

Which molecular dynamic simulation software is more applicable for protein and large-area surface interaction simulation? And how to run it?

I am trying to do the molecular dynamic simulation for protein-surface interaction, the surface (like cellulose or PET) is a film-like or crystalline material with large surface area, I had tried ...
3
votes
1answer
197 views

Where can I find the genome of the L-strain coronavirus and the S-strain coronavirus?

I read an interesting article about two strains of the coronavirus: https://www.newscientist.com/article/2236544-coronavirus-are-there-two-strains-and-is-one-more-deadly/ I would like to know how the ...
0
votes
0answers
11 views

Can non-directional and bi-directional features be described in genbank format?

I'm just wondering if there is a standard way within genbank files (.gb) to specify that a feature is non-directional or bi-directional. I don't see any info on the https://www.ncbi.nlm.nih.gov/...
1
vote
1answer
28 views

In the notch signaling pathway, what is Fringe activating?

Take a look at the notch signaling pathway in human from KEGG : https://www.genome.jp/kegg-bin/show_pathway?hsa04330 I want to know what is Fringe activating. It is not pointing to another gene or ...
1
vote
2answers
179 views

GEN file format, SNPs and alleles

I have a few questions I can't seem to get a straight answer to, regarding the .gen file format and also biology in general. The ...

1
2 3 4 5
19