If you are looking for information on Coronaviruses, we have prepared this FAQ with information on what is on topic on this site and links to some reputable external resources.

Questions tagged [coronavirus]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
2
votes
1answer
42 views

Why is the GenBank entry for the genomes of RNA viruses like coronavirus written as DNA?

The reference genome in GenBank of the sars coronavirus from Wuhan is written in the following format: attaaaggtttataccttcc (The first 20 nucleotides) ...
0
votes
1answer
12 views

Are human beings capable of producing Covid-19 Virus (SARS-CoV-2) now?

Probably SARS-CoV-2 Wikipedia is not man-made and there is no strong signature it is man-made Wikipedia. Without a real Covid-19 Virus, after knowing its gene sequence, are human beings capable of ...
0
votes
1answer
17 views

what are the factors that can be used to compute the probability of getting the coronavirus?

Our team and I work on a project for the Lauzhack 2020 and to achieve this work, we need to determine some factors that can tell us what is the probability of contracting the coronavirus. Is there ...
0
votes
1answer
10 views

How can I classify the 3 clades(S, G, V) of the coronavirus that are found on GISAID?

On GISAID they classified the corona using 4 clades(S, G, V, Other). I would like to know exactly how these genomes were classified for my research. So how do you classify a coronavirus genome as ...
1
vote
1answer
21 views

Are there COVID-19 citizen science projects to compare habits and outcomes?

I've seen some "citizen science" projects for coronavirus that are not really collaborations, but simply requests for processing time. Are there any "real" projects where people who have gotten their ...
0
votes
1answer
223 views

Is the CDC's reported drop today in COVID-19 cases by date of diagnosis meaningful?

I was waiting with bated breath for the CDC update on cases of COVID-19 in the U.S. by date of onset. To my eyes this looks like absolutely wonderful news - that it means that the exponential growth ...
-1
votes
0answers
20 views

How to develop COVID-19 pneumonia vulnerability precognition test for all? [closed]

re. How to develop COVID-19 pneumonia vulnerability precognition test for all ? Hi, I have completed Infection Prevention and Control (IPC) for Novel Coronavirus (COVID-19) course by WHO and I have ...
-3
votes
0answers
11 views

Can we kill corona virus by injecting other virus/bacteria which rely on other virus to survive? [closed]

I am not a biology student. Curiously, I am asking that if we can kill coronavirus by injecting other viruses or bacteria. They will compete with each other to survive and we help our virus to win. ...
4
votes
3answers
8k views

Ratio of bleach to water required to disinfect COVID-19?

I am confused about the needed ratio of bleach to water required to disinfect COVID-19 from surfaces. The guide on CDC states that: https://www.cdc.gov/coronavirus/2019-ncov/community/home/cleaning-...
1
vote
1answer
139 views

Why don't anti-viral drugs like “Acyclovir” work against coronaviruses?

I've always used Acyclovir to treat cold sores, why doesn't it work on other viruses? How do coronaviruses differ from herpesviruses?
24
votes
3answers
5k views

Can you be immune to a coronavirus?

Can one be immune to the new coronavirus? Another question is what is the exact definition of "being immune". Does it mean that even when the virus enters my system, it cannot multiply?
0
votes
1answer
69 views

Is touching or inhaling 70% isopropyl alcohol dangerous to humans?

I bought 99% isopropyl alcohol and made 70% alcohol + 30% water in small spraying bottles as a disinfectant. I also read that this solution is safe and recommended by Apple for cleaning iPhones. My ...
1
vote
1answer
124 views

is it possible to visualize coronavirus infection and what type of assays are routinely used?

There has been some electron micrograph of SARS-COV-2 published; but are there any fluorescent/ confocal-fluorescent image of them? or is it possible to do them? I know that viruses are usually much ...
-3
votes
0answers
67 views

Please critique my draft for a DIY SARS-CoV-2 testing facility so that I can offer these tests for free to those people in need [closed]

I hope your quarantines are going well. A little disclaimer before I move on: I am not a biologist. I am a Business major. My knowledge of biology is equivalent to that of an earlier high school ...
12
votes
2answers
585 views

Why are bats the source of dangerous coronavirus pandemics?

Why do coronaviruses come from bats? I mean, why precisely coronaviruses and not (for instance) herpesviruses? It looks like bats host more zoonotic viruses (per species) than rodents, although they ...
-7
votes
0answers
43 views

Could COVID-19 have been created in a lab using the data gained from the reconstructed 1918 Spanish Flu virus? [closed]

The 1918 Spanish Flu Pandemic virus (Influenza A, H1N1) was reconstructed in a CDC laboratory back in 2005. The CDC then published how their researchers were able to accomplish this and the article ...
2
votes
0answers
42 views

Why there is no ELISA for SARS-CoV-2?

As far as I know, SARS-CoV-2 tests currently used worldwide are real-time RT-PCR. Why there is no ELISA for SARS-CoV-2? Compared to PCRs, ELISA is: Way cheaper; Way faster; Does not require trained ...
0
votes
0answers
30 views

Would coronavirus die quicker on soap covered tissue

Is dry soap covered skin more likely to disrupt or destroy a virus more quickly, for a significant amout of time (say several hours) than clean dry skin alone, or would it make no difference? Given ...
2
votes
1answer
189 views

Is Covid-19 likely to mutate into a deadlier form?

When the Spanish influenza hit in 1918, it struck in two waves. The first wave was typical for a flu virus, targetting mainly elderly people, but the second wave was far deadlier and killed far more ...
0
votes
1answer
25 views

Does the Abbott ID NOW coronavirus test return a positive result if you take it while you're still in the incubation period?

It seems like Abbott's ID Now test works by detecting the virus directly as opposed to checking for antibodies? If the test result is negative does that mean you don't have the virus? Or does that not ...
-1
votes
0answers
25 views

Is corona virus pandemic SIS, SIR or SIRS type epidemiological model model?

This question is halway between realms of Mathematics and Epidemiology. But the particular fact I am looking for is best suited here. To put simply, which of the following cases is true for corona ...
-4
votes
0answers
22 views

Does covid-19 has any particular host? Can it do effect other living things

Till now I'm not heard about any other beings affected by the covid-19 of its correct then explain your thoughts
0
votes
0answers
27 views

Transmission of COVID-19 through domesticated animals [closed]

This is an exploratory question. If a COVID-19 infected person (person is unaware that he is infected) milks the cow for couple of days, is there a possibility of him infecting the cow thereby ...
-2
votes
0answers
94 views

What is the magnetic spectrum of SARS-CoV-2 retrotranscribed DNA when excited with a 7.8 Hz electric field? [closed]

What is the magnetic spectrum upp to 100 kHz, and eventual other electromagnetic characteristics, of SARS-CoV-2 DNA when excited with electric fields of 7.8 Hz? The DNA is the DNA resulting from the ...
1
vote
0answers
53 views

Why do we not use antibodies created by people who recovered from Corona Virus as a cure?

There are a lot of people who have already recovered from the Corona Virus. A series of events I can think of (as a 17-year-old who have taken A-level Biology) 1- Take a sample from someone who ...
0
votes
0answers
34 views

Covid-19 Lethality [closed]

So I'm not a biologist by any means. But, I was having a discussion with some friends not long back and one of them was starting to believe some of the silly conspiracy theories about COVID-19 (...
9
votes
1answer
476 views

Is COVID-19 claimed to get less deadly over time? If so, why?

From a TV news report of a press conference from (I think) the German Robert Koch Institute, I remember hearing an expert declare that he was expecting COVID-19 to get less deadly over time. ...
4
votes
0answers
131 views

How was 2019-nCoV (Wuhan coronavirus) identified so quickly?

It seems that from the first few cases to identifying 2019-nCoV as a new disease happened very quickly. How were they able to identify this as a new disease and not an outbreak of a previously known ...
1
vote
2answers
172 views

Can Coronaviridae mutate into something as dangerous as Flioviridae?

Can coronaviruses mutate to an extent to get as dangerous as fliovirusues such as Marburg viruses, Ravn or Ebola Zaire?
-1
votes
1answer
73 views

Does the prevalence of COVID-19 infections in West Europe compared to East Europe prove that BCG vaccine is helpful against Coronavirus?

Particularly, we see the apparent difference between East and West Germany: This also may explain why in Germany and in Israel it is the younger people who are mostly affected by the coronavirus (the ...
3
votes
1answer
197 views

What percentage of individuals infected with COVID-19 don't have symptoms?

There are various statistics estimating mortality of COVID-19 infections, based on how many diagnosed people have died. These numbers are used by various media to extrapolate how many people will die ...
0
votes
0answers
55 views

How does increased relative humidity change the airborne survival rate of coronavirus COVID-19?

I would like to make some HVAC recommendations in my community to assist in slowing the eventual spread of coronavirus COVID-19. Some recommendations are obvious like properly maintained HEPA ...
-1
votes
0answers
17 views

Going from droplet flying through the air to ending up in the pneumocytes in the alveoli. How does SARS-CoV-2 do it?

There was a Q and A held with George Gao, the head of the Chinese CDC, published in the most recent issue of Science, where he suggests that the data support droplets as being the main mode of ...
12
votes
2answers
610 views

Human Immune Response to COVID-19 Virus

I have tried to find an answer to this but have not found anything after multiple attempts. The question on the table is if the human body is able to produce an immune response to the COVID-19 virus ...
87
votes
2answers
13k views

What's the evidence against SARS-CoV-2 being engineered by humans?

A couple of colleagues suggested in a discussion that the virus that causes COVID-19 appears to be made by humans, since nature could not have produced such an efficient virus — that spreads so fast ...
-2
votes
0answers
37 views

Are humans living in smaller countries more likely to be affected by COVID-19? [closed]

Like many people in these days I'm keeping an eye on the Coronavirus statistics and I couldn't help noticing that the percentage/rate of people with the disease is much higher in small countries than ...
28
votes
1answer
7k views

Does the genetic sequence of SARS-CoV-2 end with 33 A's?

Looking at the DNA (or RNA?) sequence of the Covid-19 virus here: https://www.ncbi.nlm.nih.gov/nuccore/MN908947.3 I notice it ends in 33 a's. Does the virus really look like that, or is it some ...
0
votes
0answers
23 views

Are the conclusions in “The proximal origin of SARS-CoV-2” legit? [duplicate]

I don't have any background in genetics and bioinformatics, so I ask you if you think that the arguments provided in the article The proximal origin of SARS-CoV-2 by Andersen et al. are convincing. In ...
42
votes
3answers
21k views

How does a Coronavirus “test kit” work?

A number of countries are using test kits for detecting new cases of nCoV (2019-Coronavirus) and apparently China is running low. What exactly is in a nCoV "Test Kit" — How does it work? (Surely ...
-1
votes
1answer
112 views

Would “Pox Parties” of the young/healthy (while isolating the vulnerable) be an effective method of combating the COVID-19 outbreak?

It is commonly said that most people, especially the healthiest would only develop mild syndromes. Therefore, shouldn’t we, instead of confining all the population as a whole proceed as follows : ...
4
votes
4answers
115 views

What are the difficulties/challenges against developing a coronavirus vaccine?

Multiple groups of scientists are trying to develop a coronavirus vaccine but they are not yet being fruitful. What challenges or difficulties are there in the process that slowing down and/or causing ...
2
votes
0answers
34 views

How does SARS-CoV-2 spread from cell to cell in the lung? [closed]

This virus exits the cell using exocytosis after assembling golgi vesicles which contain the virus by fusing with the cell membrane. In the case of infected pneumocytes, I imagine that the virus ...
7
votes
3answers
120 views

Why does increased humidity decrease coronavirus “survival”?

All news I can see scientist telling that the SARS-CoV-2 virus survive more in cold and dry weather. I can understand cold as hot weather will desiccate virus, but why dry weather. Would not dry ...
-1
votes
1answer
71 views

A poor man's COVID-19 vaccine? [closed]

If person A is infected (COVID-19) and person B is not, could the following work as a vaccination? Person A exhales (coughs?) into a a transparent bag. The bag is radiated for a long time with a ...
-2
votes
1answer
30 views

Can someone donate antibodies? [closed]

Consider the following scenario: Person A has been infected with some virus (for example, SARS-CoV-2) Person A has recovered From this scenario, I assume Person A has managed to develop antibodies ...
0
votes
0answers
19 views

Why hasnt been developed yet a COVID-19 vaccine? [duplicate]

I'm a complete noob when it comes to biology, but as far as I remember from my biology class, a vaccine is just a the viruses itself but in small amounts so that the immune system creates memory cells....
1
vote
0answers
41 views

SARS-CoV virus stability at low temperatures

For SARS-CoV-2 and SARS-CoV1 this study published in NEJM by a NIAID team was done at a temperature of 21-23°C (see the Methods section in their supplemental material). What's known about virus ...
-2
votes
0answers
35 views

How COVID - 19 patient are recovering without cure? [closed]

How COVID - 19 patient are recovering without cure? I didn't understand how is it possible?
-1
votes
1answer
43 views

How many SARS-CoV-2 viruses in circulation at the moment? Mass? [closed]

How many SARS-CoV-2 viruses are in circulation at the moment? And what is their total mass? To clarify: if there are 10 000 viruses on average in an infected human and 100 000 humans are infected the ...
0
votes
0answers
26 views

CoV SARS killed/ depleted with temperature & humidity conditions - Any such R&D for Corona Covid-19 virus? [closed]

What are the environmental conditions for SARS-CoV-2 to survive? CoV SARS killed or depleted with temperature & humidity conditions - Is there any such R&D for Corona Covid-19 virus? The ...