If you are looking for information on Coronaviruses, we have prepared this FAQ with information on what is on topic on this site and links to some reputable external resources.

Questions tagged [coronavirus]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
87
votes
2answers
13k views

What's the evidence against SARS-CoV-2 being engineered by humans?

A couple of colleagues suggested in a discussion that the virus that causes COVID-19 appears to be made by humans, since nature could not have produced such an efficient virus — that spreads so fast ...
42
votes
3answers
21k views

How does a Coronavirus “test kit” work?

A number of countries are using test kits for detecting new cases of nCoV (2019-Coronavirus) and apparently China is running low. What exactly is in a nCoV "Test Kit" — How does it work? (Surely ...
28
votes
1answer
7k views

Does the genetic sequence of SARS-CoV-2 end with 33 A's?

Looking at the DNA (or RNA?) sequence of the Covid-19 virus here: https://www.ncbi.nlm.nih.gov/nuccore/MN908947.3 I notice it ends in 33 a's. Does the virus really look like that, or is it some ...
24
votes
3answers
5k views

Can you be immune to a coronavirus?

Can one be immune to the new coronavirus? Another question is what is the exact definition of "being immune". Does it mean that even when the virus enters my system, it cannot multiply?
21
votes
1answer
874 views

What are the environmental conditions for SARS-CoV-2 to survive?

What do we know about the environmental limits for nCoV to survive outside the body? For example, in: In open air On surfaces In water What are the limits for temperature, humidity and air pressure,...
17
votes
1answer
3k views

Why would a 2019-nCoV protein sequence in the NCBI database match a protein submitted in 2018?

There seems to be a bit of a conspiracy theory brewing over some data in the NCBI database, and I don't have the necessary knowledge to make sense of it. It basically goes like this: Go to NCBI ...
14
votes
1answer
8k views

How many times has SARS-CoV-2 mutated?

According to Coronavirus has mutated at least once The novel coronavirus that has infected thousands of people across the world may have mutated at least once — meaning there may be two ...
12
votes
2answers
610 views

Human Immune Response to COVID-19 Virus

I have tried to find an answer to this but have not found anything after multiple attempts. The question on the table is if the human body is able to produce an immune response to the COVID-19 virus ...
12
votes
2answers
585 views

Why are bats the source of dangerous coronavirus pandemics?

Why do coronaviruses come from bats? I mean, why precisely coronaviruses and not (for instance) herpesviruses? It looks like bats host more zoonotic viruses (per species) than rodents, although they ...
9
votes
1answer
476 views

Is COVID-19 claimed to get less deadly over time? If so, why?

From a TV news report of a press conference from (I think) the German Robert Koch Institute, I remember hearing an expert declare that he was expecting COVID-19 to get less deadly over time. ...
7
votes
1answer
152 views

Role of Prevalence in Estimating Coronavirus Mortality

Let there be a sample of 10,000 people. 100 of them have a fever. You test them for COVID19 and they all come out positive. 5 of them die, 9 of them end up in intensive care. The estimated mortality ...
7
votes
3answers
120 views

Why does increased humidity decrease coronavirus “survival”?

All news I can see scientist telling that the SARS-CoV-2 virus survive more in cold and dry weather. I can understand cold as hot weather will desiccate virus, but why dry weather. Would not dry ...
6
votes
2answers
290 views

How do bats survive their own coronaviruses?

How do bats survive their own coronaviruses (without showing any symptoms)? Or, more generically, how can viruses keep reproducing inside healthy carriers without inducing any pathogenic effect? Are ...
6
votes
1answer
1k views

What is the size (diameter) of the SARS-CoV-2 virus?

You can easily find a lot of pictures of the SARS-CoV-2 virus. But although it should be trivial for an electron microscope to measure the size, I am not able to ...
6
votes
1answer
194 views

Can COVID-19 affect a person a second time?

I keep hearing people are recovering from COVID-19 virus. Is there any chance that same person can become infected with COVID-19 for a second time?
6
votes
1answer
97 views

How is the protease inhibited by lopinavir different in SARS-CoV-2 compared to SARS-CoV?

The protease inhibitor lopinavir, originally developed as a cure against AIDS and HIV, has been shown efficient against SARS Coronavirus SARS-CoV. Dayer M R, Taleb-Gassabi S, Dayer M S. Lopinavir; ...
5
votes
1answer
156 views

Why are victims of Covid19 being wrapped in plastic?

Several articles describe the unique ways Covid-19 patients are being buried. For example, in this Reuters article about Israel: These included decontaminating and hermetically wrapping bodies in ...
5
votes
1answer
94 views

How does sunlight affect the longevity of SARS-CoV-2 on surface?

UV radiation is known to degrade most viruses rather quickly. How does the UV radiation from sunlight affect the longevity of SARS-CoV-2 on surfaces. Of particular interest to me is the virus' ...
5
votes
0answers
123 views

How does a virus stick to a non-biological surface?

Recent events has triggered an renewed interest in understanding how a virus is able to stay on a surface. For sake of argument, let's assume we are dealing with a Corona-type virus. One can then ...
4
votes
3answers
8k views

Ratio of bleach to water required to disinfect COVID-19?

I am confused about the needed ratio of bleach to water required to disinfect COVID-19 from surfaces. The guide on CDC states that: https://www.cdc.gov/coronavirus/2019-ncov/community/home/cleaning-...
4
votes
4answers
115 views

What are the difficulties/challenges against developing a coronavirus vaccine?

Multiple groups of scientists are trying to develop a coronavirus vaccine but they are not yet being fruitful. What challenges or difficulties are there in the process that slowing down and/or causing ...
4
votes
1answer
83 views

What gene targets associated with the new coronavirus (SARS-CoV-2) have been identified so far?

One hypothesis for which we have some supporting evidence is that the new virus (SARS-CoV-2) "enters human cells through an interaction with angiotensin-converting enzyme 2" see here. Although it is ...
4
votes
1answer
52 views

Are there any documented instances of coronaviruses being directly transmitted from bats to humans?

Many human coronaviruses have ancestral host origins in species of bat. However, all instances I am aware of identified other animals as intermediary vectors: SARS-CoV: Human ← Palm Civet / Raccoon ← ...
4
votes
0answers
131 views

How was 2019-nCoV (Wuhan coronavirus) identified so quickly?

It seems that from the first few cases to identifying 2019-nCoV as a new disease happened very quickly. How were they able to identify this as a new disease and not an outbreak of a previously known ...
3
votes
1answer
666 views

Can coronavirus contaminate public water systems? [closed]

It's been reported recently that people are panic-buying stuff as the coronavirus epidemic worsens. I've even noticed that the local grocery store is low on hand sanitizer, paper towels, and bottled ...
3
votes
1answer
133 views

Where can I find the genome of the L-strain coronavirus and the S-strain coronavirus?

I read an interesting article about two strains of the coronavirus: https://www.newscientist.com/article/2236544-coronavirus-are-there-two-strains-and-is-one-more-deadly/ I would like to know how the ...
3
votes
1answer
197 views

What percentage of individuals infected with COVID-19 don't have symptoms?

There are various statistics estimating mortality of COVID-19 infections, based on how many diagnosed people have died. These numbers are used by various media to extrapolate how many people will die ...
3
votes
1answer
165 views

Does a higher body temperature slow the corona virus down?

The corona virus appearantly does not like high temperature: High Temperature and High Humidity Reduce the Transmission of COVID-19 Also it seems that higher body temperatures helps the immune system ...
3
votes
1answer
93 views

What differentiates diseases like Covid-19 and Polio from the common cold

Why are vaccines required for our body's immune system to destroy viruses that cause the likes of Covid-19 or Polio, while viruses that cause the common-cold are self-limiting (go away on their own)? ...
3
votes
0answers
20 views

How does the immune system distinguish between a TH1 and a TH2 response?

Hello and thanks for taking the time to read my post. I know that naive T-Cells (T0) can be induced to become mature T-Helper cells (TH1 or TH2) by induction with either IL2 or IL4. IL2+ TH0 -> TH1 ...
2
votes
2answers
126 views

If the covid-19 appeared once, could it reappear anytime?

Governments are imposing confinement measures on their populations, trusting that if there is no more transmission the virus will die out. But since this coronavirus appeared a first time, what could ...
2
votes
2answers
102 views

Do Angiotensin II Receptor Blockers (ARBs) or other factors control the level of ACE2 expression? [coronavirus receptor]

Because ACE2 is used by SARS-NCoV-2 to enter the cell, I am curious what factors determine its expression. Interestingly, myocardial infarction increases ACE2 expression in the heart in an animal ...
2
votes
1answer
43 views

Why is the GenBank entry for the genomes of RNA viruses like coronavirus written as DNA?

The reference genome in GenBank of the sars coronavirus from Wuhan is written in the following format: attaaaggtttataccttcc (The first 20 nucleotides) ...
2
votes
1answer
55 views

Can you be infected by two coronaviruses at once?

E.g. could you be infected by COVID-19 as well as a different strand of coronaviruses (e.g. those that circulate in the population every flu season)?
2
votes
1answer
101 views

Viral mutation rates and replication

TL;DR What's the relationship between the following? Mutation rates (expressed as "mutations per year" for a virus like e.g. COVID-19 (SARS-CoV-2). E.g. this article mentions "The rate looks to be ...
2
votes
1answer
189 views

Is Covid-19 likely to mutate into a deadlier form?

When the Spanish influenza hit in 1918, it struck in two waves. The first wave was typical for a flu virus, targetting mainly elderly people, but the second wave was far deadlier and killed far more ...
2
votes
0answers
42 views

Why there is no ELISA for SARS-CoV-2?

As far as I know, SARS-CoV-2 tests currently used worldwide are real-time RT-PCR. Why there is no ELISA for SARS-CoV-2? Compared to PCRs, ELISA is: Way cheaper; Way faster; Does not require trained ...
2
votes
0answers
34 views

How does SARS-CoV-2 spread from cell to cell in the lung? [closed]

This virus exits the cell using exocytosis after assembling golgi vesicles which contain the virus by fusing with the cell membrane. In the case of infected pneumocytes, I imagine that the virus ...
2
votes
0answers
20 views

Would symptoms differ from eating virus contaminated food versus breathing in virus?

Would symptoms differ from eating virus contaminated food versus breathing in virus? The COVID-19 causes respiratory symptoms and I guess that is because people are breathing in virus droplets in ...
2
votes
0answers
48 views

L strain of SARS-CoV-2?

Early in the epidemic, Chinese researchers (Jian Lu, et al,) reported in the National Science Review earlier this month that there was an aggressive more virulent L strain compared to the older S ...
2
votes
0answers
57 views

Could blood transfusions from COVID19 surviver be worth researching as a possible form of treatment

As a general viral immunology question (rather than seeking personal medical advice). Would a blood transfusion from a COVID19 surviver to a sufferer be worth researching as a possible form of ...
2
votes
0answers
150 views

Paper shows 2 hours of high humidity and hot temperatures kills corona virus, does this stop the spread of the virus?

I found this paper (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2863430/) which says these corona virus strains live for months at 4 degrees C, 20% relative humidity. But at 40 degrees C and 80% ...
1
vote
1answer
139 views

Why don't anti-viral drugs like “Acyclovir” work against coronaviruses?

I've always used Acyclovir to treat cold sores, why doesn't it work on other viruses? How do coronaviruses differ from herpesviruses?
1
vote
1answer
124 views

is it possible to visualize coronavirus infection and what type of assays are routinely used?

There has been some electron micrograph of SARS-COV-2 published; but are there any fluorescent/ confocal-fluorescent image of them? or is it possible to do them? I know that viruses are usually much ...
1
vote
2answers
172 views

Can Coronaviridae mutate into something as dangerous as Flioviridae?

Can coronaviruses mutate to an extent to get as dangerous as fliovirusues such as Marburg viruses, Ravn or Ebola Zaire?
1
vote
1answer
133 views

Using decoy proteins to treat viral illness

As a non-biologist, my understanding is SARS-CoV-2 uses it spike protein to latch on to the ACE2 receptor on cells in order to inject its genetic material into the cell. Questions: What would happen ...
1
vote
1answer
70 views

Covid-19: Is it possible to get to r0 < 1 through social distancing measures?

I'm trying to wrap my head around some of the information I'm reading about how to fight Covid-19 and conflicting opinions about how much "social distancing" is required to avert a disaster, or ...
1
vote
1answer
21 views

Are there COVID-19 citizen science projects to compare habits and outcomes?

I've seen some "citizen science" projects for coronavirus that are not really collaborations, but simply requests for processing time. Are there any "real" projects where people who have gotten their ...
1
vote
0answers
53 views

Why do we not use antibodies created by people who recovered from Corona Virus as a cure?

There are a lot of people who have already recovered from the Corona Virus. A series of events I can think of (as a 17-year-old who have taken A-level Biology) 1- Take a sample from someone who ...
1
vote
0answers
41 views

SARS-CoV virus stability at low temperatures

For SARS-CoV-2 and SARS-CoV1 this study published in NEJM by a NIAID team was done at a temperature of 21-23°C (see the Methods section in their supplemental material). What's known about virus ...