Questions tagged [coronavirus]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
95
votes
3answers
16k views

What's the evidence against SARS-CoV-2 being engineered by humans?

A couple of colleagues suggested in a discussion that the virus that causes COVID-19 appears to be made by humans, since nature could not have produced such an efficient virus — that spreads so fast ...
57
votes
2answers
12k views

Are the social-distancing measures implemented against SARS-CoV-2 also suppressing the spread of other viruses?

With social-distancing measures being implemented in many countries I would expect other viruses, like the ones that cause seasonal flus, to have also a hard time propagating in these circumstances. ...
44
votes
3answers
23k views

How does a Coronavirus “test kit” work?

A number of countries are using test kits for detecting new cases of nCoV (2019-Coronavirus) and apparently China is running low. What exactly is in a nCoV "Test Kit" — How does it work? (Surely ...
36
votes
4answers
5k views

Why do some viruses cease being a problem even though no vaccine or cure is found?

No vaccine or cure has been found for SARS-CoV or MERS-CoV yet the world is not too concerned about them. How can it be? Did all people who had those viruses die or do viruses just randomly decide to ...
32
votes
3answers
6k views

Can you be immune to a coronavirus?

Can one be immune to the new coronavirus? Another question is what is the exact definition of "being immune". Does it mean that even when the virus enters my system, it cannot multiply?
28
votes
1answer
7k views

Does the genetic sequence of SARS-CoV-2 end with 33 A's?

Looking at the DNA (or RNA?) sequence of the Covid-19 virus here: https://www.ncbi.nlm.nih.gov/nuccore/MN908947.3 I notice it ends in 33 a's. Does the virus really look like that, or is it some ...
25
votes
1answer
1k views

What are the environmental conditions for SARS-CoV-2 to survive?

What do we know about the environmental limits for nCoV to survive outside the body? For example, in: In open air On surfaces In water What are the limits for temperature, humidity and air pressure,...
18
votes
4answers
3k views

What does vaccine efficacy mean?

In the last few weeks, Pfizer/BionTech, Moderna and AstraZeneca have each released preliminary estimates of the efficacy of their SARS-COV-2 vaccines. But what do their respective efficacy percentages ...
16
votes
1answer
3k views

Why would a 2019-nCoV protein sequence in the NCBI database match a protein submitted in 2018?

There seems to be a bit of a conspiracy theory brewing over some data in the NCBI database, and I don't have the necessary knowledge to make sense of it. It basically goes like this: Go to NCBI ...
15
votes
1answer
8k views

How many times has SARS-CoV-2 mutated?

According to Coronavirus has mutated at least once The novel coronavirus that has infected thousands of people across the world may have mutated at least once — meaning there may be two ...
15
votes
2answers
850 views

Human Immune Response to COVID-19 Virus

I have tried to find an answer to this but have not found anything after multiple attempts. The question on the table is if the human body is able to produce an immune response to the COVID-19 virus ...
14
votes
4answers
764 views

What are the difficulties/challenges against developing a coronavirus vaccine?

Multiple groups of scientists are trying to develop a coronavirus vaccine but they are not yet being fruitful. What challenges or difficulties are there in the process that slowing down and/or causing ...
13
votes
3answers
751 views

What are the implications of tigers being susceptible to SARS-CoV-2?

It was recently reported that a handful of tigers and lions tested positive at the Bronx Zoo for SARS-CoV-2 (see here and here). Does this imply that the SARS-CoV-2 strain in humans mutated into a ...
12
votes
1answer
2k views

Coronavirus capsid missing?

According to several sources, Coronavirus is a helical virus, i.e. it should have a helical capsid. Although most sources did not labelled or pointed any kind of capsid. It was mysterious to watch ...
12
votes
2answers
654 views

Why are bats the source of dangerous coronavirus pandemics?

Why do coronaviruses come from bats? I mean, why precisely coronaviruses and not (for instance) herpesviruses? It looks like bats host more zoonotic viruses (per species) than rodents, although they ...
9
votes
2answers
333 views

How do bats survive their own coronaviruses?

How do bats survive their own coronaviruses (without showing any symptoms)? Or, more generically, how can viruses keep reproducing inside healthy carriers without inducing any pathogenic effect? Are ...
9
votes
1answer
868 views

Is COVID-19 claimed to get less deadly over time? If so, why?

From a TV news report of a press conference from (I think) the German Robert Koch Institute, I remember hearing an expert declare that he was expecting COVID-19 to get less deadly over time. ...
9
votes
1answer
2k views

Could someone explain the join in the SARS-cov-2 genome at location 13468?

I am having trouble understanding the reference sequence for sars-cov-2, NC_045512.2 Three nucleotides equals one amino acid, right? But the nucleotide at position 13468 seems to be used twice, so ...
9
votes
3answers
183 views

Why does increased humidity decrease coronavirus “survival”?

All news I can see scientist telling that the SARS-CoV-2 virus survive more in cold and dry weather. I can understand cold as hot weather will desiccate virus, but why dry weather. Would not dry ...
9
votes
2answers
420 views

How does sunlight affect the longevity of SARS-CoV-2 on surface?

UV radiation is known to degrade most viruses rather quickly. How does the UV radiation from sunlight affect the longevity of SARS-CoV-2 on surfaces. Of particular interest to me is the virus' ...
8
votes
1answer
310 views

Can COVID-19 affect a person a second time?

I keep hearing people are recovering from COVID-19 virus. Is there any chance that same person can become infected with COVID-19 for a second time?
8
votes
1answer
185 views

Role of Prevalence in Estimating Coronavirus Mortality

Let there be a sample of 10,000 people. 100 of them have a fever. You test them for COVID19 and they all come out positive. 5 of them die, 9 of them end up in intensive care. The estimated mortality ...
7
votes
1answer
6k views

What is the size (diameter) of the SARS-CoV-2 virus?

You can easily find a lot of pictures of the SARS-CoV-2 virus. But although it should be trivial for an electron microscope to measure the size, I am not able to ...
7
votes
1answer
660 views

Why are men more susceptible to severe COVID-19?

It seems that globally, men are more susceptible to severe COVID-19 than women: https://www.theguardian.com/world/2020/mar/26/men-are-much-more-likely-to-die-from-coronavirus-but-why This is seen in ...
7
votes
0answers
141 views

How does a virus stick to a non-biological surface?

Recent events has triggered an renewed interest in understanding how a virus is able to stay on a surface. For sake of argument, let's assume we are dealing with a Corona-type virus. One can then ...
6
votes
1answer
118 views

Herd immunity without vaccines? (corona question)

Obviously there is herd immunity against many viruses such as measles because of vaccines. Can we say that there is herd immunity against any particular virus even though people are not getting ...
6
votes
1answer
128 views

How is the protease inhibited by lopinavir different in SARS-CoV-2 compared to SARS-CoV?

The protease inhibitor lopinavir, originally developed as a cure against AIDS and HIV, has been shown efficient against SARS Coronavirus SARS-CoV. Dayer M R, Taleb-Gassabi S, Dayer M S. Lopinavir; ...
6
votes
1answer
128 views

What is the lipid membrane of SARS-CoV-2 made of?

SARS-CoV-2 is an enveloped virus: in structural diagrams it is drawn with membrane glycoprotein (M), envelope protein (E) and spike protein (S) embedded in a lipid membrane. What specifically is the ...
5
votes
1answer
116 views

How common are the “common” human coronaviruses?

I was listening to a virology expert on the Swedish radio yesterday. He said that there already were several corona viruses among humans that only affected children because basically all the adults ...
5
votes
1answer
198 views

Why are victims of Covid19 being wrapped in plastic?

Several articles describe the unique ways Covid-19 patients are being buried. For example, in this Reuters article about Israel: These included decontaminating and hermetically wrapping bodies in ...
5
votes
0answers
118 views

Why is the SARS-CoV-2 target receptor ACE2 not endocytosed when bound physiologically?

The COVID-19 coronavirus SARS-CoV-2 enters cells by receptor-mediated endocytosis. See, e.g. here. Why doesn’t the enzyme ACE2 — SARS-CoV-2’s target receptor — undergo endocytosis when bound by its ...
4
votes
3answers
18k views

Ratio of bleach to water required to disinfect COVID-19?

I am confused about the needed ratio of bleach to water required to disinfect COVID-19 from surfaces. The guide on CDC states that: https://www.cdc.gov/coronavirus/2019-ncov/community/home/cleaning-...
4
votes
2answers
439 views

Where can I find SARS-CoV-2 genome sequences for the UK?

I have downloaded and analysed the sequences of 832 complete samples from the European Nucleotide Archive but I cannot find a single one that was from the UK. I have also tried Genbank and they do not ...
4
votes
1answer
785 views

is it possible to visualize coronavirus infection and what type of assays are routinely used?

There has been some electron micrograph of SARS-COV-2 published; but are there any fluorescent/ confocal-fluorescent image of them? or is it possible to do them? I know that viruses are usually much ...
4
votes
1answer
104 views

Triangulation number of the SARS CoV-19 virus

Is the triangulation number of the SARS CoV-19 virus capsid, in the sense of the Caspar-Klug theory, known? In case the Caspar-Klug theory does not apply to it, is it known what is its tiling, in ...
4
votes
1answer
94 views

What gene targets associated with the new coronavirus (SARS-CoV-2) have been identified so far?

One hypothesis for which we have some supporting evidence is that the new virus (SARS-CoV-2) "enters human cells through an interaction with angiotensin-converting enzyme 2" see here. Although it is ...
4
votes
1answer
137 views

Factors of infection rate

I refer to J.H. Jones' Notes on R0. Preliminaries The standard SIR model consists of a system of three differential equations $$ds/dt = -\beta s i$$ $$di/dt = \beta s i - \nu i$$ $$dr/dt = \nu i$...
4
votes
1answer
62 views

Are there any documented instances of coronaviruses being directly transmitted from bats to humans?

Many human coronaviruses have ancestral host origins in species of bat. However, all instances I am aware of identified other animals as intermediary vectors: SARS-CoV: Human ← Palm Civet / Raccoon ← ...
4
votes
1answer
78 views

Why do COVID19 serology tests focus on the nucleocapsid while vaccine efforts focus on the spike?

When I look at the specification sheets for many of today's serology tests like the new Roche test or the Abbott test, they use a nucleocapsid antigen in the test, looking for anti-nucleocapsid ...
4
votes
0answers
75 views

Why there is no ELISA for SARS-CoV-2?

As far as I know, SARS-CoV-2 tests currently used worldwide are real-time RT-PCR. Why there is no ELISA for SARS-CoV-2? Compared to PCRs, ELISA is: Way cheaper; Way faster; Does not require trained ...
4
votes
0answers
140 views

How was 2019-nCoV (Wuhan coronavirus) identified so quickly?

It seems that from the first few cases to identifying 2019-nCoV as a new disease happened very quickly. How were they able to identify this as a new disease and not an outbreak of a previously known ...
3
votes
3answers
282 views

Muller's ratchet and viruses

Do viruses suffer from Muller's ratchet? Can it significantly influence the current coronavirus pandemic?
3
votes
2answers
73 views

How do PARPs counteract coronaviruses?

I read that [SARS-CoV-2 has] a nonstructural protein called NSP3, a component of which blocks the host’s efforts to fight off the virus. In particular, this protein shuts down host enzymes called ...
3
votes
1answer
91 views

How a person can transmit COVID-19 while his COVID-19 is still in incubation state?

A person with SARS 2003 cannot transmit that disease while his SARS is in incubation state but how a person with COVID-19 is transmitting COVID-19 even though his COVID-19 is in incubation period?
3
votes
1answer
104 views

Why is the GenBank entry for the genomes of RNA viruses like coronavirus written as DNA?

The reference genome in GenBank of the sars coronavirus from Wuhan is written in the following format: attaaaggtttataccttcc (The first 20 nucleotides) ...
3
votes
1answer
721 views

Can coronavirus contaminate public water systems? [closed]

It's been reported recently that people are panic-buying stuff as the coronavirus epidemic worsens. I've even noticed that the local grocery store is low on hand sanitizer, paper towels, and bottled ...
3
votes
2answers
170 views

Is the coronavirus getting less dangerous?

Please note This question is based on data from the UK government's web site (data from the ONS). I am not taking this data as accurate, but am using this as it is the only source of data I can find, ...
3
votes
1answer
71 views

How the vaccine based on “non replicating viral vector” is produced?

As I understand, this kind of vaccine is a virus that can infect the cell, start synthesis of proteins encoded by its genome, but cannot finish the replication cycle till the proper end. It can have ...
3
votes
1answer
197 views

Where can I find the genome of the L-strain coronavirus and the S-strain coronavirus?

I read an interesting article about two strains of the coronavirus: https://www.newscientist.com/article/2236544-coronavirus-are-there-two-strains-and-is-one-more-deadly/ I would like to know how the ...
3
votes
1answer
194 views

Does a higher body temperature slow the corona virus down?

The corona virus appearantly does not like high temperature: High Temperature and High Humidity Reduce the Transmission of COVID-19 Also it seems that higher body temperatures helps the immune system ...